PRECLINICAL STUDIES
Involvement of the Nicotinamide Adenosine Dinucleotide Phosphate Oxidase Isoform Nox2 in Cardiac Contractile Dysfunction Occurring in Response to Pressure Overload
David J. Grieve, PhD,
Jonathan A. Byrne, PhD, MRCP,
Anjana Siva, PhD, MRCP,
Joanne Layland, PhD,
Sofian Johar, MRCP,
Alison C. Cave, PhD and
Ajay M. Shah, MD, FAHA*
King's College London, Cardiovascular Division, Guy's, King's, and St. Thomas' School of Medicine, London, England
Manuscript received January 1, 2005;
revised manuscript received September 14, 2005,
accepted September 19, 2005.
* Reprint requests and correspondence: Dr. Ajay M. Shah, Department of Cardiology, GKT School of Medicine, Bessemer Road, London SE5 9PJ England (Email: ajay.shah{at}kcl.ac.uk).
 |
Abstract
|
|---|
OBJECTIVES: This study sought to examine the role of Nox2 in the contractile dysfunction associated with pressure-overload left ventricular hypertrophy (LVH).
BACKGROUND: Reactive oxygen species (ROS) production is implicated in the pathophysiology of LVH. The nicotinamide adenosine dinucleotide phosphate oxidase isoform, Nox2, is pivotally involved in angiotensin II-induced hypertrophy but is not essential for development of pressure-overload LVH. Its possible impact on contractile function is unknown.
METHODS: The effects of aortic banding or sham surgery on cardiac contractile function and interstitial fibrosis were compared in adult Nox2/ and matched wild-type (WT) mice.
RESULTS: Banding induced similar increases in left ventricular (LV) mass in both groups. Banded Nox2/ mice had better LV function than WT by echocardiography (e.g., fractional shortening 33.6 ± 2.5% vs. 21.4 ± 2.2%, p < 0.05). Comprehensive LV pressure-volume analyses also showed significant contractile dysfunction in banded WT compared with sham, whereas banded Nox2/ mice had preserved function (e.g., maximum rate of rise of LV pressure: banded WT, 4,879 ± 213; vs. banded Nox2/, 5,913 ± 259 mm Hg/s; p < 0.05). Similar preservation of function was observed in isolated cardiomyocytes. The 24-h to 36-h treatment of banded WT mice with N-acetylcysteine resulted in recovery of contractile function. Cardiac interstitial fibrosis was significantly increased in banded WT but not Nox2/ mice, together with greater increases in procollagen I and III mRNA expression.
CONCLUSIONS: The Nox2 oxidase contributes to the development of cardiac contractile dysfunction and interstitial fibrosis during pressure overload, although it is not essential for development of morphologic hypertrophy per se. These data suggest divergent downstream effects of Nox2 on different components of the overall response to pressure overload.
An increase in oxidative stress is implicated in the pathophysiology of left ventricular hypertrophy (LVH) (1). Increased reactive oxygen species (ROS) production occurs both in experimental models of cardiomyocyte hypertrophy and with in vivo pressure-overload LVH, whereas antioxidants may exert beneficial effects in experimental in vivo LVH and heart failure (26). The ROS influence LVH pathophysiology through several mechanisms. Increased ROS production contributes to development of cardiomyocyte hypertrophy induced by G-proteincoupled receptor agonists, cytokines, and mechanical stretch, at least in part through activation of redox-sensitive protein kinases and transcription factors (36). Oxidative stress promotes myocyte apoptosis and necrosis, especially in advanced hypertrophy and heart failure (1,3,7). The ROS may also alter cardiac contractile properties, for example by modulating the function of sarcolemmal ion channels/exchangers, sarcoplasmic reticular proteins, myofilaments, and/or enzymes involved in energy metabolism (810). Finally, ROS contribute to endothelial dysfunction through inactivation of nitric oxide, and also promote interstitial fibrosis and extracellular matrix remodeling (1,11).
Given these effects of oxidative stress, elucidation of the roles of different ROS sources (e.g., mitochondria, xanthine oxidase, uncoupled nitric oxide synthases) is important. In this regard, recent studies from several laboratories, including our own, have addressed the potential involvement of nicotinamide adenosine dinucleotide phosphate (NADPH) oxidases in LVH pathophysiology. These superoxide-generating enzymes are major cardiovascular ROS sources, particularly in the vasculature, where they play important roles in hypertension, atherosclerosis, angiogenesis, and other conditions (12). The prototypic NADPH oxidase (first characterized in neutrophils) comprises a membrane-bound heterodimer consisting of one gp91phox (or Nox2) and one p22phox subunit, and several regulatory subunits (p47phox, p67phox, p40phox, and Rac) that associate with the heterodimer in the activated enzyme complex (12,13). The Nox subunit is the catalytic core of the oxidase and, recently, several isoforms (Nox1 to 5) were identified that have specific tissue distributions and may subserve distinct (patho)physiological functions (13). The major isoforms expressed in heart seem to be Nox2 and Nox4, with the Nox2 oxidase found in cardiomyocytes, fibroblasts, and endothelial cells (12,1416).
The NADPH oxidases are implicated in cardiomyocyte hypertrophic signaling in response to angiotensin II (AngII) or alpha-adrenergic agonists (16,17), whereas Rac1 (which is involved in oxidase activation) induces cardiomyocyte hypertrophy (18,19). Increased cardiac NADPH oxidase expression and activity was shown in experimental pressure-overload LVH, with evidence that ROS derived from the oxidase may contribute to contractile dysfunction in this setting (14,20,21). Similarly, increased NADPH oxidase activity was also documented in failing human hearts (22,23). Recently, we began to specifically investigate the role of the Nox2 oxidase in the development of cardiac hypertrophy (15,24). In Nox2-deficient mice (Nox2/) (25), LVH induced by short-term subpressor AngII infusion was substantially inhibited together with abolition of AngII-induced NADPH oxidase activation (24). In marked contrast, increases in LV mass and myocyte size during pressure overload induced by aortic banding were similar in Nox2/ and wild-type (WT) mice, indicating that Nox2 is not essential for development of pressure-overload LVH (15). The latter findings were confirmed by Maytin et al. (26). Because ROS potentially affect several aspects of cardiac structure and function, however, these studies do not address the role of Nox2 in other components of the overall response to pressure overload. In the present study, we examined the role of Nox2 in the contractile dysfunction and fibrosis associated with pressure-overload LVH.
 |
Methods
|
|---|
Experimental LVH.
Adult male Nox2/ and matched WT littermate controls underwent suprarenal abdominal aortic banding or sham surgery (15). Banding caused similar increases in invasively measured systolic blood pressure in WT (sham, 90 ± 3 mm Hg; banded, 135 ± 5 mm Hg) and Nox2/ mice (sham, 86 ± 3 mm Hg; banded, 130 ± 8 mm Hg). Some animals were pretreated with N-acetylcysteine (500 mg/kg/day in drinking water) for 24 to 36 h before being killed. All procedures were performed in accordance with the Guidance on the Operation of the Animals (Scientific Procedures) Act, 1986 (United Kingdom).
Histology.
Interstitial fibrosis was assessed in frozen LV sections (6 µm) by Picrosirius red staining. Blinded quantitative image analysis (Openlab, Improvision, Coventry, United Kingdom), excluding coronary vessels and perivascular regions, was undertaken (27). Immunohistochemistry for 3-nitrotyrosine (28) was performed with a rabbit polyclonal antibody (Upstate Biotechnology, Dundee, United Kingdom; 1:1,000), using diaminobenzidine for final visualization and counterstaining with nuclear fast red (DakoCytomation, Glostrup, Denmark). Non-immune rabbit immunoglobulin G was used as a negative control.
Real-time reverse transcriptase-polymerase chain reaction..
Expression of atrial natriuretic factor (ANF), procollagen I/III, and fibronectin mRNA were analyzed by real-time reverse transcriptase-polymerase chain reaction with fluorescent SYBR Green technology on a Prism 7000 HT system (Applied Biosystems, Warrington, United Kingdom), using glyceraldehyde-3-phosphate dehydrogenase mRNA for normalization (15). The primers were (5' to 3'): glyceraldehyde-3-phosphate dehydrogenase forward CGTGCCGCCTGGAGAA, reverse CCCTCAGATGCCTGCTTCAC; ANF forward CGTGCCCCGACCCACGCCAGCATGGGCTCC, reverse GGCTCCGAGGGCCAGCGAGCAGAGCCCTCA; procollagen I 1 forward CCTCAGGGTATTGCTGGACAAC, reverse TTGATCCAGAAGGACCTTGTTTG; procollagen III 1 forward AGGAGCCAGTGGCCATAATG, reverse TGACCATCTGATCCAGGGTTTC; fibronectin forward CCGGTGGCTGTCAGTCAGA, reverse CCGTTCCCACTGCTGATTTATC. The comparative Ct method was used for relative quantification, with validation experiments showing approximately equal efficiencies of primers. All samples were run in triplicate, and data were expressed in arbitrary units.
Echocardiography.
Mice were anesthetized with 1% to 1.5% isoflurane/oxygen and placed on a warming pad. Images were acquired using a Sonos 5500 system with a 15 MHz linear probe (Philips, Bothell, Washington). Two-dimensional LV short-axis views were acquired at the papillary muscle level, and M-mode recordings were made. Depth settings were adjusted to maximize frame rate (220 to 260 Hz) and optimize temporal resolution. The interventricular septal thickness in diastole (IVSD) and the left ventricular end-diastolic and end-systolic dimensions (LVEDD and LVESD, respectively) were measured using three consecutive cycles.
LV pressure-volume analyses.
Left ventricular function was analyzed in isolated ejecting hearts under controlled loading and heart rate of 450 bpm (29,30). A custom 1.4-F microconductance catheter (SPR-853; Millar Instruments, Houston, Texas) was inserted into the LV apex for measurement of volume and high-fidelity pressure. Atrial inflow and aortic outflow were measured by ultrasonic transit probes (1N; Transonic Systems, Ithaca, New York). Left atrial filling pressure (preload) was varied from 10 to 25 cm H2O to generate Starling curves. The LV pressure-volume relationships were also studied during transient occlusion of the aortic outflow tract, and end-systolic and end-diastolic pressure-volume relations (ESPVR and EDPVR, respectively) were determined. Absolute volume measurements were corrected for alpha and parallel conductance (30,31).
Cardiomyocytes.
Ventricular myocytes were isolated by collagenase digestion, and single myocyte shortening was quantified (29).
Statistics.
Between 5 and 10 animals per group were studied for all protocols. Data were analyzed by two-way repeated measures ANOVA, one-way ANOVA, or an unpaired Student's t test, as appropriate. p < 0.05 was considered significant.
 |
Results
|
|---|
Development of LVH.
Consistent with our previous study (15), two weeks of pressure overload caused similar increases in the LV:body weight ratio in banded WT (4.57 ± 0.29 mg/g vs. 3.21 ± 0.07 mg/g, p < 0.05) and Nox2/ (4.87 ± 0.18 mg/g vs. 3.40 ± 0.07 mg/g, p < 0.05) versus shams. Atrial, right ventricular, lung, and body weights were similar between groups. The ANF mRNA expression increased to a similar extent in banded WT and Nox2/ versus sham (WT, 16.7 ± 2.1 arbitrary units vs. 2.3 ± 0.1 arbitrary units; Nox2/, 19.3 ± 3.6 arbitrary units vs. 2.9 ± 1.5 arbitrary units, p < 0.05).
Interstitial fibrosis.
After 2 weeks, interstitial fibrosis increased significantly in banded WT mice compared with sham (63 ± 11%, p < 0.05) but no significant change occurred in banded Nox2/ mice (Fig. 1A). Procollagen I and III mRNA were also significantly increased in banded WT mice (Figs. 1B and 1C). In contrast, no significant increase in procollagen I mRNA occurred in banded Nox2/ mice, whereas the increase in procollagen III mRNA was significantly lower than in banded WT. Fibronectin mRNA did not increase in any group (Fig. 1D).

View larger version (11K):
[in this window]
[in a new window]
|
Figure 1 Effect of pressure overload on cardiac fibrosis. (A) Interstitial collagen assessed in left ventricular (LV) sections stained with Picrosirius red. (B to D) messenger ribonuclerc acid expression of procollagen I, procollagen III, and fibronectin. Data are mean ± SEM from six animals. *p < 0.05 versus corresponding sham; p < 0.05 versus banded Nox2/. WT = wild type.
|
|
Echocardiography.
Consistent with the morphometric data, banded WT and Nox2/ mice showed similar increases in IVSD after two weeks (Table 1). Fractional shortening was significantly reduced in banded WT mice compared with sham, with a significant increase in LVESD. In contrast, neither LVESD nor fractional shortening were significantly altered in banded Nox2/ mice. Heart rate and LVEDD were similar among groups.
LV pressure-volume analyses.
Table 2 shows parameters of steady-state cardiac function in WT and Nox2/ mice, studied two weeks after surgery. Banded WT mice showed significant reductions in LVdP/dtmax, end-systolic pressure, and ejection fraction, and an increase in end-systolic volume compared with sham, indicating impaired systolic function. LVdP/dtmin was also significantly reduced, and isovolumic relaxation time-constant (Tau) increased in banded WT mice, indicating impaired relaxation. None of these parameters were significantly altered in banded Nox2/ mice.
Figure 2 shows LVdP/dtmax, LVdP/dtmin, and stroke work measured across a range of LV volumes and confirms significant reductions in these parameters in banded WT mice but preservation of function in banded Nox2/ mice. The differences in stroke work between WT and Nox2/ mice are further appreciated from the representative LV pressure-volume loops shown in Figures 3A and 3D, in which stroke work is the area of the loop.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 2 Left ventricular (LV) function in isolated ejecting hearts from wild-type (WT) and Nox2/ mice across a range of LV end-diastolic volumes (EDV). Changes in A and D: maximum rate of rise of LV pressure (LVdP/dtmax); changes in B and E: maximum rate of fall of LV pressure (LVdP/dtmin); changes in C and F: stroke work (SW). Data are mean ± SEM from eight animals. *p < 0.05 banded (solid squares) versus sham (open squares).
|
|

View larger version (34K):
[in this window]
[in a new window]
|
Figure 3 Representative examples of left ventricular (LV) pressure-volume analyses in banded (solid squares) and sham-operated (open squares) wild-type (WT) and Nox2/ mice. (A and D) Steady-state pressure-volume loops. (B and E) End-systolic pressure relation (ESPVR). (C and F) End-diastolic pressure volume relation (EDPVR).
|
|
Figure 3 shows representative examples of data obtained during transient aortic occlusion. The slope of the ESPVR was significantly decreased in banded WT mice, indicating reduced contractility, but was unaltered in banded Nox2/ mice (Figs. 3B and 3E). The slope of the EDPVR was significantly increased in banded WT mice, indicating increased diastolic stiffness, but was unaltered in banded Nox2/ mice (Figs. 3C and 3E). Mean data are shown in Table 2.
Cardiomyocyte function.
To assess whether differences in contractile function found at the whole-heart level were also present at the cellular level, we studied isolated cardiomyocytes. Myocytes from banded WT mice had significantly reduced twitch shortening (by 20%) compared with sham (Figs. 4A and 4C). In contrast, the shortening of myocytes from banded Nox2/ mice was non-significantly reduced (Figs. 4B and 4D).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 4 Effect of pressure overload on cell shortening (CS) in cardiomyocytes from wild-type (WT) and Nox2/ mice. (A and B) Representative traces of myocyte contraction. (C and D) Mean ± SEM from 60 cells from four hearts. Dark columns = banded mice; lighter columns = shams. *p < 0.05 versus sham.
|
|
Effect of N-acetylcysteine.
Treatment with the antioxidant N-acetylcysteine for 36 h before killing at the two-week post-surgical time point resulted in normalization of echocardiographic fractional shortening and LVESD in banded WT mice (Figs. 5A and 5C); heart rate, IVSD, and LVEDD (Fig. 5B) were unaffected. N-acetylcysteine also increased LVdP/dtmax, stroke work, ESPVR (Figs. 5D to 5F), ejection fraction, and LVdP/dtmin (data not shown) in isolated ejecting hearts of banded WT mice. Furthermore, in vivo N-acetylcysteine treatment for 24 h significantly improved contraction of cardiomyocytes isolated from banded WT hearts (e.g., shortening velocity, untreated, 2.0 ± 0.07 µms1; treated, 2.9 ± 0.16 µms1; p < 0.05), but had minimal effects in the sham group (untreated, 2.4 ± 0.07 µms1, treated, 2.6 ± 0.11 µms1; p = NS). A similar improvement of contractility was found with addition of N-acetylcysteine to isolated hearts or myocytes for 15 to 20 min, but this effect did not stabilize over this time period (i.e., continued to increase).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 5 Effect of N-acetylcysteine on cardiac function assessed (A to C) by echocardiography and (D to F) in isolated ejecting hearts. Light columns = control animals; darker columns = N-acetylcysteine-treated animals. Data are mean ± SEM from eight animals. *p < 0.05 versus corresponding control.
|
|
To assess whether the effects of N-acetylcysteine were attributable to reduced oxidative stress, we assessed 3-nitrotyrosine staining in LV sections. Banded WT hearts showed increased 3-nitrotyrosine staining, but this was significantly reduced in hearts from banded animals treated with N-acetylcysteine for 36 h (Fig. 6).

View larger version (154K):
[in this window]
[in a new window]
|
Figure 6 Representative left ventricular (LV) sections from wild-type (WT) mice stained for 3-nitrotyrosine (20x magnification). (A) Sham, (B) banded; (C) N-acetylcysteine-treated sham; (D) N-acetylcysteine-treated banded.
|
|
Contractile function after eight weeks of pressure overload..
To assess whether the differences in contractile function between WT and Nox2/ mice persisted after longer durations of pressure overload, animals were studied at eight weeks after surgery. Figure 7 shows cardiac functional parameters measured in isolated ejecting hearts. Banded WT mice showed substantial reductions in LVdP/dtmax, LVdP/dtmin, and cardiac work compared with shams, which were greater than those observed after two weeks (Fig. 3). Banded Nox2/ mice now also showed significant reductions in LVdP/dtmax, LVdP/dtmin, and cardiac work, but the degree of impairment remained much less than in banded WT mice.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 7 Left ventricular (LV) function in isolated ejecting hearts from wild-type (WT) and Nox2/ mice eight weeks after surgery. Changes in (A and D): LVdP/dtmax; (B and E) LVdP/dtmin; and (C and F) cardiac work (CW). Data are mean ± SEM from five to six animals. *p < 0.05 banded (solid squares) versus sham (open squares).
|
|
 |
Discussion
|
|---|
The major novel finding of this study is that the Nox2 NADPH oxidase contributes to development of cardiac contractile dysfunction and interstitial fibrosis in response to pressure overload, even though it is not essential for development of LVH per se. The Nox2 oxidase therefore influences specific components of the overall response to pressure overload, indicating that related but distinct components of the overall cardiac hypertrophic phenotype may be subject to independent regulation.
Oxidative stress is recognized to be involved in LVH pathophysiology, but the precise roles of different ROS sources remains unclear (16). Furthermore, the possibility of divergent effects on contractile function or interstitial fibrosis as opposed to increases in LV mass has not been widely addressed. Recent work suggests a role for NADPH oxidases in the development of cardiac hypertrophy and interstitial fibrosis (14,21,24). A relatively unique attribute of NADPH oxidases in contrast to other ROS sources (e.g., mitochondria, xanthine oxidase) is that ROS generation in response to specific stimuli and subsequent modulation of downstream signal transduction seems to be a primary function of these enzymes (12,13). In addition, the presence of at least two cardiac Nox isoforms (Nox2 and Nox4) raises the possibility of not only stimulus-specific but also isoform-specific roles (12,13,15). Our previous findings that LVH induced by subpressor AngII was inhibited in Nox2/ mice (24) indicated that Nox2-derived ROS are specifically involved in cardiac AngII signaling. Consistent with this, AngII-induced cardiac hypertrophy and fibrosis were inhibited in mice lacking apoptosis signal-regulating kinase 1, which is known to be redox-sensitive (32). However, Nox2/ mice developed a similar degree of LVH to WT animals in response to pressure overload (15,26), indicating that even though Nox2 mediates hypertrophy in response to AngII, other pathways may be more important or may substitute for Nox2 when the stimulus is pressure overload. Nevertheless, the current study shows that Nox2 plays a major role in the development of interstitial fibrosis and contractile dysfunction in response to pressure overload. Interestingly, pressure overload was found to increase NADPH oxidase activity and ROS production even in Nox2/ mice, secondary to upregulation of Nox4 in these animals (15). This finding, together with the results of the present study, indicates that the downstream effects of Nox2 during pressure overload are highly specific; i.e., neither Nox4 nor other ROS sources apparently promotes fibrosis or contractile dysfunction in Nox2/ mice.
Previous seminal studies have established that although cardiomyocyte hypertrophy and interstitial fibrosis often co-exist, they are to a significant extent independently regulated (33). Oxidative stress is pro-fibrotic both in the heart and in other organs, by stimulating fibroblast proliferation, collagen deposition, and activation of matrix metalloproteinases (1,3335). The novel finding of the current study is the demonstration of a specific role for the Nox2 oxidase in promoting interstitial cardiac fibrosis during pressure overload. Inhibition of interstitial fibrosis in banded Nox2/ mice was shown both by histology and real-time reverse transcriptase-polymerase chain reaction. Taken together with previous data indicating an involvement of Nox2 in AngII-induced cardiac, vascular, and hepatic fibrosis (24,28,36), these results may suggest a broader role of Nox2 in mediating pathological fibrosis.
The other major effect of Nox2 was found to be in the development of contractile dysfunction during pressure overload. We undertook detailed characterization of contractile function by both echocardiography in vivo and LV pressure-volume analyses in isolated ejecting hearts. The WT mice had significant systolic dysfunction after two weeks of pressure overload as evidenced by reduced echocardiographic fractional shortening, increased LVESD, and reduction in pressure (LVdP/dtmax) and volume-based indices (LV end-systolic volume and ejection fraction) as well as the slope of the ESPVR. Banded WT mice also had impaired relaxation (reduced LVdP/dtmin, prolonged tau) and evidence of diastolic dysfunction (increased slope of EDPVR). In marked contrast, none of these parameters were significantly altered in banded Nox2/ mice. Furthermore, brief (24-h to 36-h) treatment with the antioxidant N-acetylcysteine improved contractile function and reduced LV 3-nitrotyrosine staining in WT bands, suggesting that the dysfunction was indeed mediated via ROS. Whereas we previously showed that chronic (two-week) treatment with N-acetylcysteine inhibited the development of pressure-overload hypertrophy (15), the current brief (24-h to 36-h) protocol was specifically chosen to investigate effects on contractile function independent of hypertrophy. With more prolonged pressure overload (eight weeks), we found that contractile dysfunction did develop in Nox2/ mice but the magnitude of dysfunction remained less than with banded WT. These data suggest that Nox2 may be particularly important for contractile dysfunction in the early stages of pressure overload. With more prolonged overload, it is likely that other mechanisms, such as ROS-independent abnormalities of excitation-contraction coupling and energetic deficit, may also become relevant (37). Our results contrast with a recently published study in which no differences in cardiac function were found between Nox2/ and WT mice subjected to aortic constriction (26). However, in that study, the pressure overload was probably much more severe than in the present study because it resulted in >50% LVH after just one week and 50% mortality, compared with <20% mortality in our study. These data leave open the possibility that the contribution of Nox2 to contractile dysfunction during pressure overload may depend on the degree of overload, a question that warrants further investigation.
Increased ROS production may lead to contractile dysfunction through several mechanisms, including alterations in cellular energetics, changes in excitation-contraction coupling, and/or alterations in myofilament calcium responsiveness (1,810,38). At the whole-heart level, contractile function may also be influenced by alterations in the extracellular matrix (11). In the current study, we found significant differences in function of cardiomyocytes isolated from banded Nox2/ and WT, suggesting that a significant proportion of the contractile dysfunction in whole hearts may be attributable to intrinsic myocyte dysfunction. However, the differences in diastolic properties observed between banded Nox2/ and WT may be related to the observed changes in interstitial fibrosis. The precise mechanisms underlying Nox2-dependent contractile dysfunction require further investigation, but our preliminary studies do not show significant differences in expression of SERCA2a or phospholamban between banded Nox2/ and WT (data not shown).
In summary, this study shows that the Nox2 NADPH oxidase specifically contributes to the development of both contractile dysfunction and interstitial fibrosis in response to pressure overload, despite not being essential for the development of LVH per se. This divergent regulation of LV hypertrophy and LV function is analogous to a number of other recent reports of experimental models in which these aspects of cardiac hypertrophy have been found to be independently regulated, e.g., by the PI3K-PTEN pathway (39,40) and the MEKK1-JNK pathway (41). Also analogous to these reports, the Nox2 oxidase in the heart not only seems to be activated in an isoform-specific manner, but also exerts isoform-specific downstream effects on distinct components of the overall cardiac hypertrophic phenotype. These data underscore the likely importance of independent redox regulation of different aspects of the cardiac response to pressure overload.
 |
Footnotes
|
|---|
Supported by British Heart Foundation (BHF) Program Grant RG/03/008. Dr. Shah holds the BHF Chair of Cardiology at King's College London. Drs. Grieve and Byrne contributed equally to this work.
 |
References
|
|---|
1 Dhalla NS, Temsah RM, Netticadan T. Role of oxidative stress in cardiovascular diseases J Hypertens 2000;18:655-673.[CrossRef][Web of Science][Medline]2 Nakamura K, Fushimi K, Kouchi H, et al. Inhibitory effects of antioxidants on neonatal rat cardiac myocyte hypertrophy induced by tumor necrosis factor- and angiotensin II Circulation 1998;98:794-799.[Abstract/Free Full Text] 3 Pimentel DR, Amin JK, Xiao L, et al. Reactive oxygen species mediate amplitude-dependent hypertrophic and apoptotic responses to mechanical stretch in cardiac myocytes Circ Res 2001;89:453-460.[Abstract/Free Full Text] 4 Hirotani S, Otsu K, Nishida K, et al. Involvement of nuclear factor- B and apoptosis signal-regulating kinase 1 in G-protein-coupled receptor agonist-induced cardiomyocyte hypertrophy Circulation 2002;105:509-515.[Abstract/Free Full Text] 5 Yamamoto M, Yang G, Hong C, et al. Inhibition of endogenous thioredoxin in the heart increases oxidative stress and cardiac hypertrophy J Clin Invest 2003;112:1395-1406.[CrossRef][Web of Science][Medline] 6 Takemoto M, Node K, Nakagami H, et al. Statins as antioxidant therapy for preventing cardiac myocyte hypertrophy J Clin Invest 2001;108:1429-1437.[CrossRef][Web of Science][Medline] 7 Cesselli D, Jakoniuk I, Barlucchi L, et al. Oxidative stress-mediated cardiac cell death is a major determinant of ventricular dysfunction and failure in dog dilated cardiomyopathy Circ Res 2001;89:279-286.[Abstract/Free Full Text] 8 Josephson RA, Silverman HS, Lakatta EG, Stern MD, Zweier JL. Study of the mechanisms of hydrogen peroxide and hydroxyl free radical-induced cellular injury and calcium overload in cardiac myocytes J Biol Chem 1991;266:2354-2361.[Abstract/Free Full Text] 9 Gao WD, Liu Y, Marban E. Selective effects of oxygen free radicals on excitation-contraction coupling in ventricular muscleImplications for the mechanism of stunned myocardium. Circulation 1996;94:2597-2604.[Abstract/Free Full Text] 10 Xie YW, Kaminski PM, Wolin MS. Inhibition of rat cardiac muscle contraction and mitochondrial respiration by endogenous peroxynitrite formation during posthypoxic reoxygenation Circ Res 1998;82:891-897.[Abstract/Free Full Text] 11 Kinugawa S, Tsutsui H, Hayashidani S, et al. Treatment with dimethylthiourea prevents left ventricular remodeling and failure after experimental myocardial infarction in miceRole of oxidative stress. Circ Res 2000;87:392-398.[Abstract/Free Full Text] 12 Griendling KK, Sorescu D, Ushio-Fukai M. NAD(P)H oxidaseRole in cardiovascular biology and disease. Circ Res 2000;86:494-501.[Abstract/Free Full Text] 13 Lambeth JD. Nox enzymes and the biology of reactive oxygen Nat Rev Immunol 2004;4:181-189.[CrossRef][Web of Science][Medline] 14 Li JM, Gall NP, Grieve DJ, Chen M, Shah AM. Activation of NADPH oxidase during progression of cardiac hypertrophy to failure Hypertension 2002;40:477-484.[Abstract/Free Full Text] 15 Byrne JA, Grieve DJ, Bendall JK, et al. Contrasting roles of NADPH oxidase isoforms in pressure overload versus angiotensin II-induced cardiac hypertrophy Circ Res 2003;93:802-805.[Abstract/Free Full Text] 16 Xiao L, Pimentel DR, Wang J, Singh K, Colucci WS, Sawyer DB. Role of reactive oxygen species and NAD(P)H oxidase in 1-adrenoceptor signaling in adult rat cardiac myocytes Am J Physiol Cell Physiol 2002;282:C926-C934.[Abstract/Free Full Text] 17 Wenzel S, Taimor G, Piper HM, Schluter KD. Redox-sensitive intermediates mediate angiotensin II-induced p38 MAP kinase activation, AP-1 binding activity, and TGF-ß expression in adult ventricular cardiomyocytes FASEB J 2001;15:2291-2293.[Free Full Text] 18 Pracyk JB, Tanaka K, Hegland DD, et al. A requirement for the rac1 GTPase in the signal transduction pathway leading to cardiac myocyte hypertrophy J Clin Invest 1998;102:929-937.[Web of Science][Medline] 19 Higuchi Y, Otsu K, Nishida K, et al. The small GTPase binding protein Rac1 induces cardiac myocyte hypertrophy through the activation of apoptosis signal-regulating kinase 1 and nuclear factor- B J Biol Chem 2003;278:20770-20777.[Abstract/Free Full Text] 20 MacCarthy PA, Grieve DJ, Li JM, Dunster C, Kelly FJ, Shah AM. Impaired endothelial regulation of ventricular relaxation in cardiac hypertrophy: role of reactive oxygen species and NADPH oxidase Circulation 2001;104:2967-2974.[Abstract/Free Full Text] 21 Nadruz Jr. W, Lagosta VJ, Moreno Jr. H, Coelho OR, Franchini KG. Simvastatin prevents load-induced protein nitration in overloaded hearts Hypertension 2004;43:1060-1066.[Abstract/Free Full Text] 22 Heymes C, Bendall JK, Ratajczak P, et al. Increased myocardial NADPH oxidase activity in human heart failure J Am Coll Cardiol 2003;41:2164-2171.[Abstract/Free Full Text] 23 Maack C, Kartes T, Kilter H, et al. Oxygen free radical release in human failing myocardium is associated with increased activity of Rac1-GTPase and represents a target for statin therapy Circulation 2003;108:1567-1574.[Abstract/Free Full Text] 24 Bendall JK, Cave AC, Heymes C, Gall N, Shah AM. Pivotal role of gp91phox-containing NADPH oxidase in angiotensin II-induced cardiac hypertrophy Circulation 2002;105:293-296.[Abstract/Free Full Text] 25 Pollock JD, Williams DA, Gifford MA, et al. Mouse model of X-linked chronic granulomatous disease, an inherited defect in phagocyte superoxide production Nat Genet 1995;9:202-209.[CrossRef][Web of Science][Medline] 26 Maytin M, Siwik DA, Ito M, et al. Pressure overload-induced myocardial hypertrophy in mice does not require gp91phox Circulation 2004;109:1168-1171.[Abstract/Free Full Text] 27 Brilla CG, Janicki JS, Weber KT. Impaired diastolic function and coronary reserve in genetic hypertension: role of interstitial fibrosis and medial thickening of intramyocardial coronary arteries Circ Res 1991;69:107-115.[Abstract/Free Full Text] 28 Wang HD, Xu S, Johns DG, et al. Role of NADPH oxidase in the vascular hypertrophic and oxidative stress response to angiotensin II in mice Circ Res 2001;88:947-953.[Abstract/Free Full Text] 29 Layland J, Grieve DJ, Cave AC, Sparks E, Solaro RJ, Shah AM. Essential role of troponin I in the positive inotropic response to ß-adrenergic stimulation in the ejecting mouse heart J Physiol 2004;556:835-847.[Abstract/Free Full Text] 30 Grieve DJ, Cave AC, Byrne JA, Layland J, Shah AM. Analysis of ex vivo left ventricular pressure-volume relations in the isolated murine ejecting heart Exp Physiol 2004;89:573-582.[Abstract/Free Full Text] 31 Georgakopoulos D, Mitzner WA, Chen CH, et al. In vivo murine left ventricular pressure-volume relations by miniaturized conductance micromanometry Am J Physiol 1998;274:H1416-H1422. 32 Izumiya Y, Kim S, Izumi Y, et al. Apoptosis signal-regulating kinase 1 plays a pivotal role in angiotensin II-induced cardiac hypertrophy and remodeling Circ Res 2003;93:874-883.[Abstract/Free Full Text] 33 Weber KT. Extracellular matrix remodeling in heart failureA role for de novo angiotensin II generation. Circulation 1997;96:4065-4082.[Free Full Text] 34 Irani K, Xia Y, Zweier JL, et al. Mitogenic signaling mediated by oxidants in Ras-transformed fibroblasts Science 1997;275:1649-1652.[Abstract/Free Full Text] 35 Poli G, Parola M. Oxidative damage and fibrogenesis Free Radic Biol Med 1997;22:287-305.[CrossRef][Web of Science][Medline] 36 Bataller R, Schwabe RF, Choi YH, et al. NADPH oxidase signal transduces angiotensin II in hepatic stellate cells and is critical in hepatic fibrosis J Clin Invest 2003;112:1383-1394.[CrossRef][Web of Science][Medline] 37 Hunter JJ, Chien KR. Signaling pathways for cardiac hypertrophy and failure N Engl J Med 1999;341:1276-1283.[CrossRef][Web of Science][Medline] 38 Ide T, Tsutsui H, Hayashidani S, et al. Mitochondrial DNA damage and dysfunction associated with oxidative stress in failing hearts after myocardial infarction Circ Res 2001;88:529-535.[Abstract/Free Full Text] 39 Crackower MA, Oudit GY, Kozieradzki I, et al. Regulation of myocardial contractility and cell size by distinct PI3K-PTEN signalling pathways Cell 2002;110:737-749.[CrossRef][Web of Science][Medline] 40 Patrucco E, Notte A, Barberis L, et al. PI3K modulates the cardiac response to chronic pressure overload by distinct kinase-dependent and -independent effects Cell 2004;118:375-387.[CrossRef][Web of Science][Medline] 41 Sadoshima J, Montagne O, Wang Q, et al. The MEKK1-JNK pathway plays a protective role in pressure overload but does not mediate cardiac hypertrophy J Clin Invest 2002;110:271-279.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
P. A. Arias-Loza, K. Hu, S. Frantz, C. Dienesch, B. Bayer, R. Wu, G. Ertl, and T. Pelzer
Medroxyprogesterone Acetate Aggravates Oxidative Stress and Left Ventricular Dysfunction in Rats with Chronic Myocardial Infarction
Toxicol Pathol,
August 1, 2011;
39(5):
867 - 878.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-H. Yeh, C.-T. Kuo, T.-H. Chan, G.-J. Chang, X.-Y. Qi, F. Tsai, S. Nattel, and W.-J. Chen
Transforming growth factor-{beta} and oxidative stress mediate tachycardia-induced cellular remodelling in cultured atrial-derived myocytes
Cardiovasc Res,
July 1, 2011;
91(1):
62 - 70.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhao, D. McLaughlin, E. Robinson, A. P. Harvey, M. B. Hookham, A. M. Shah, B. J. McDermott, and D. J. Grieve
Nox2 NADPH Oxidase Promotes Pathologic Cardiac Remodeling Associated with Doxorubicin Chemotherapy
Cancer Res.,
November 15, 2010;
70(22):
9287 - 9297.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lancel, F. Qin, S. L. Lennon, J. Zhang, X. Tong, M. J. Mazzini, Y. J. Kang, D. A. Siwik, R. A. Cohen, and W. S. Colucci
Short Communication: Oxidative Posttranslational Modifications Mediate Decreased SERCA Activity and Myocyte Dysfunction in G{alpha}q-Overexpressing Mice
Circ. Res.,
July 23, 2010;
107(2):
228 - 232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Young, J. Morgan, K. Brolin, P. J. Fuller, and J. W. Funder
Activation of Mineralocorticoid Receptors by Exogenous Glucocorticoids and the Development of Cardiovascular Inflammatory Responses in Adrenalectomized Rats
Endocrinology,
June 1, 2010;
151(6):
2622 - 2628.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Bergamini, M. Cicoira, A. Rossi, and C. Vassanelli
Oxidative stress and hyperuricaemia: pathophysiology, clinical relevance, and therapeutic implications in chronic heart failure
Eur J Heart Fail,
May 1, 2009;
11(5):
444 - 452.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Monassier, M.-A. Laplante, F. Jaffre, P. Bousquet, L. Maroteaux, and J. de Champlain
Serotonin 5-HT2B Receptor Blockade Prevents Reactive Oxygen Species-Induced Cardiac Hypertrophy in Mice
Hypertension,
August 1, 2008;
52(2):
301 - 307.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. H. Looi, D. J. Grieve, A. Siva, S. J. Walker, N. Anilkumar, A. C. Cave, M. Marber, M. J. Monaghan, and A. M. Shah
Involvement of Nox2 NADPH Oxidase in Adverse Cardiac Remodeling After Myocardial Infarction
Hypertension,
February 1, 2008;
51(2):
319 - 325.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. A. Williams and D. G. Allen
The role of reactive oxygen species in the hearts of dystrophin-deficient mdx mice
Am J Physiol Heart Circ Physiol,
September 1, 2007;
293(3):
H1969 - H1977.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Seddon, Y. H Looi, and A. M Shah
Oxidative stress and redox signalling in cardiac hypertrophy and heart failure
Heart,
August 1, 2007;
93(8):
903 - 907.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Takimoto and D. A. Kass
Role of Oxidative Stress in Cardiac Hypertrophy and Remodeling
Hypertension,
February 1, 2007;
49(2):
241 - 248.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Zimmet and J. M. Hare
Nitroso-Redox Interactions in the Cardiovascular System
Circulation,
October 3, 2006;
114(14):
1531 - 1544.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. Murdoch, M. Zhang, A. C. Cave, and A. M. Shah
NADPH oxidase-dependent redox signalling in cardiac hypertrophy, remodelling and failure
Cardiovasc Res,
July 15, 2006;
71(2):
208 - 215.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|