CLINICAL RESEARCH: HEART FAILURE
Reduced Nicotinamide Adenine Dinucleotide Phosphate Oxidase-Derived Superoxide and Vascular Endothelial Dysfunction in Human Heart Failure
Rafa Dworakowski, MD, PhD*,
Simon Walker*,
Aziz Momin, FRCS*,
Jatin Desai, FRCS*,
Ahmed El-Gamel, FRCS*,
Olaf Wendler, MD, PhD*,
Mark T. Kearney, MD, FRCP and
Ajay M. Shah, MD, FMedSci*,*
* Cardiovascular Division, King’s College London School of Medicine, London, United Kingdom
Leeds Institute for Genetics, Health and Therapeuticss, University of Leeds, Leeds, United Kingdom.
Manuscript received October 1, 2007;
revised manuscript received December 12, 2007,
accepted December 17, 2007.
* Reprint requests and correspondence: Prof. Ajay M. Shah, Cardiovascular Division, James Black Centre, King’s College London, 125 Coldharbour Lane, London SE5 9NU, U.K. (Email: ajay.shah{at}kcl.ac.uk).
 |
Abstract
|
|---|
Objectives: We investigated the role of reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase in endothelial dysfunction in human heart failure.
Background: Vascular endothelial dysfunction in human heart failure contributes to increased tone, exercise limitation, and dysregulation of venous capacitance and vascular volume. The NADPH oxidases (Nox) are an important source of oxidative stress, but their role in the endothelial dysfunction of human heart failure remains unknown.
Methods: Endothelium-dependent and -independent vasorelaxation were assessed in saphenous vein segments obtained from consecutive patients with heart failure (n = 19) or normal left ventricular function (control; n = 35) undergoing coronary artery bypass graft. Saphenous vein superoxide production was measured by lucigenin-enhanced chemiluminescence and messenger ribonucleic acid expression of relevant transcripts quantified by real-time polymerase chain reaction.
Results: Heart failure patients had significantly worse endothelial function than control subjects (15.2 ± 3% vs. 40.5 ± 8.4% relative relaxation; p < 0.05), elevated C-reactive protein (CRP) levels (8.6 ± 2.7 mg/l vs. 2.6 ± 0.4 mg/l; p < 0.05), over 2-fold higher NADPH-dependent superoxide generation (p < 0.05), and significantly higher expression of the Nox4 isoform and regulatory subunit p67phox. Superoxide levels were positively correlated with New York Heart Association functional class (r = 0.684; p < 0.05) and CRP (r = 0.501; p < 0.005; n = 32).
Conclusions: Venous endothelial dysfunction in human heart failure is associated with increased Nox-derived superoxide generation. Inflammatory mechanisms may be involved in the increased reactive oxygen species generation.
|
Abbreviations and Acronyms
| | CABG = coronary artery bypass graft | | CHF = chronic heart failure | | CRP = C-reactive protein | | DPI = diphenyleneiodonium | | EF = ejection fraction | | IL = interleukin | | LV = left ventricle/ventricular | | NADPH = nicotinamide adenine dinucleotide phosphate | | NO = nitric oxide | | NOS = nitric oxide synthase | | Nox = nicotinamide adenine dinucleotide phosphate oxidase(s) | | ROS = reactive oxygen species | | SNP = sodium nitroprusside | | TNF = tumor necrosis factor |
|
The endothelium modulates vascular tone through the regulated release of vasodilator agents, notably nitric oxide (NO). Endothelial vasodilator dysfunction in the setting of human chronic heart failure (CHF) may contribute to increased arterial tone, increased systemic vascular resistance, and exercise limitation due to inability to sufficiently augment skeletal muscle perfusion (1,2). An increase in venous tone may contribute to dysregulation of vascular volume and increased ventricular preload (3,4). Additionally, endothelial dysfunction is a predictor of adverse outcome in CHF patients (5).
A major factor underlying impaired endothelium-dependent vasorelaxation is a reduction in NO bioavailability. Human studies have reported that both acute and chronic administration of the antioxidant vitamin C improves NO-mediated vasodilatation in CHF (6). These and other studies (7,8) suggest that endothelial dysfunction in human CHF may result from increased degradation of NO by reactive oxygen species (ROS). However, the mechanisms underlying increased vascular ROS levels in CHF patients remain to be fully defined.
Potential sources of vascular ROS include the reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidases (Nox), uncoupled NO synthases (NOS), and xanthine oxidase (9). Among these, in animal models, increased Nox-derived ROS generation is implicated in driving endothelial dysfunction in hypertension, hypercholesterolemia, atherosclerosis, and diabetes (9,10). However, the role of Nox in vascular endothelial dysfunction in human CHF has not been investigated. Interestingly, increased Nox expression and activity contributed to aortic endothelial dysfunction in experimental models of CHF (11,12). Increased Nox activity has been documented in the myocardium of humans with CHF (13).
This study aimed to investigate the role of Nox in endothelial dysfunction in human CHF. To correlate vasorelaxation with the expression of different Nox isoforms and biochemical activity, we studied ex vivo saphenous vein segments obtained from patients with CHF and those with normal left ventricular (LV) function undergoing coronary artery bypass graft (CABG).
|
Methods
|
|---|
Patients.
Consecutive patients undergoing CABG at King’s College Hospital (London) were considered for inclusion in the study, which was approved by the local research ethics committee. All subjects provided written informed consent. We studied 19 patients with a diagnosis of CHF based on conventional criteria, i.e., typical clinical symptoms of exertional breathlessness plus echocardiographic evidence of impaired LV systolic function (LV ejection fraction [EF] <45%). Thirty-five patients without any symptoms of heart failure and with LV EF >50% were included as control subjects.
Saphenous veins were harvested without distension and with minimal tissue handling. Immediately after collection, part of the vein was placed in ice-cold pre-oxygenated physiological buffer for organ bath studies, and a portion was snap-frozen in liquid nitrogen and stored at –80°C for messenger ribonucleic acid isolation or superoxide assays.
Plasma assays.
Fasting blood samples were obtained before surgery for measurement of serum total cholesterol, high-density lipoprotein (HDL) cholesterol, low-density lipoprotein (LDL) cholesterol, triglycerides, glucose, and creatinine. Serum samples were stored at –80°C until analysis. C-reactive protein (CRP) was measured using a high-sensitivity turbidimetric immunoassay (Wako Chemicals, Neuss, Germany) on a Cobas Mira Analyser (Roche Diagnostics, Burgess Hill, U.K.). The lowest CRP concentration that was detectable was 0.2 mg/l. The coefficient of variation (CV) for within-batch variability was 3.1% at 5.0 mg/l. Tumor necrosis factor (TNF)- and interleukin (IL)-6 were measured using a commercial enzyme-linked immunosorbent assay (R&D Systems, Minneapolis, Minnesota). The CV for TNF- was 9% and for IL-6 <9%.
Vasomotor studies.
Saphenous vein rings were suspended in organ baths containing Krebs-Henseleit solution (composition, mmol/l: NaCl 119, KCl 4.7, KH2PO4 1.18, NaHCO3 25, MgSO4 1.19, CaCl2 2.5, glucose 11.0) at 37°C, and bubbled with 95% O2/5% CO2 to maintain a pH of 7.4 (14). Resting tension was set at 3 g, and after 45 min equilibration maximal contractile response to 80 mmol/l KCl was assessed followed by a cumulative dose-response curve to phenylephrine (1 nmol/l to 1 mmol/l). Relaxation responses to cumulative addition of acetylcholine (1 nmol/l to 0.01 mmol/l) and sodium nitroprusside (SNP) (0.1 nmol/l to 0.1 mmol/l) were studied in rings pre-constricted to 70% maximal phenylephrine tension.
Vascular ROS.
Superoxide production was measured in vein homogenates using lucigenin-enhanced chemiluminescence in a 96-well microplate luminometer, with NADPH (300 µmol/l) and dark-adapted lucigenin (5 µmol/l) (15). Superoxide production was expressed as arbitrary light units over 20 min. In some experiments, one of the following was pre-incubated for 15 min to assess potential sources of superoxide production: a cell-permeable superoxide scavenger Tiron (4,5-dihydroxy-1,3-benzene disulfonic acid, 20 mmol/l), diphenyleneiodonium (DPI, a flavoprotein inhibitor, 10 µmol/l), L-NAME (NG-nitro-L-arginine methyl ester, an NOS inhibitor, 100 µmol/l), allopurinol (a xanthine oxidase inhibitor, 100 µmol/l), or rotenone (a complex I mitochondrial electron chain inhibitor, 2 µmol/l).
Real-time polymerase chain reaction (PCR).
Ribonucleic acid was isolated using RNeasy Fibrous Tissue Kit (Qiagen, Crawley, U.K.). Complementary DNA was synthesized using Omniscript kit (Qiagen) and random decamers. Real-time PCR was performed with an Abi Prism 7700 machine (Applied Biosystems, Foster City, California) using Sybr Green and universal thermal cycling parameters. Expression levels were determined using standard curves from known amounts of template and normalized to β-actin. Primer sequences were: Nox1 forward CACAAGAAAAATCCTTGGGTCAA, reverse GACAGCAGATTGCGACACACA; Nox2 forward CAAGATGCGTGGAAACTACCTAAGAT, reverse CCCTGCTCCCACTAACATCA; Nox4 forward CAGCAAGATACCGAGATGAGGA, reverse GTAGAGGCTGTGATCATGAGGAATAG; eNOS forward GAACAGCACAAGAGTTATAAGATCCG, reverse GCACTGTCTGTGTTACTGGACTCCT; p67phox forward GCACTACAAGTACACGGTAGTCATGAA, reverse CGAGGCCGATAGCTCAGCT; p47phox forward TTCAAGGTGCGCCCTGAT, reverse TGATGTCTGTCGCGGTACTCTT; and β-actin forward GCGAGAAGATGACCCAGATCA, reverse TCACCGGAGTCCATCACGAT.
The investigators undertaking vasomotor studies, superoxide generation, and real-time PCR were blinded to study groups.
Statistics.
Analyses were performed using the SPSS 13 statistical package (SPSS Inc., Chicago, Illinois). Data were expressed as mean ± SEM. Baseline comparisons between patient groups or treatments were performed using chi-square test, unpaired Student t test, 1-way analysis of variance followed by a Scheffe test or a nonparametric Mann-Whitney test as appropriate. Non-normally distibuted data were log transformed before t tests. Levene test was used to test homogeneity of variance. Variables with evidence of heterogeneity of variance were analyzed with nonparametric tests. Correlation between continuous variables was assessed by simple linear Pearson correlation and between continuous variables and ordinal variables by linear regression. Logistic regression analysis was used to assess the impact of multiple variables on vascular superoxide production. We built a stepwise model of potential influencing variables on superoxide release and then carried out the hierarchic backward elimination process to determine the best fit. p < 0.05 was considered to be statistically significant.
|
Results
|
|---|
Patient characteristics.
Clinical characteristics are shown in Table 1. The CHF patients had significantly reduced EF (37.5 ± 1.7%), whereas all control subjects had EF >50%. The precise value of EF >50% was not available in all control subjects. The 2 groups were well matched for age, gender, smoking status, hypertension, and hypercholesterolemia. Extent of coronary artery disease was also similar in the control and CHF groups: 2-vessel disease 11% vs. 10%, 3-vessel disease 51% vs. 63%, and left main disease 37% vs. 26%, respectively. As expected, the CHF group had more patients with diabetes, previous myocardial infarction, and impaired renal function (creatinine >105 mmol/l). Fasting cholesterol and triglyceride levels were similar in the 2 groups (data not shown).
Significantly more CHF than control patients were taking angiotensin-converting enzyme inhibitors and/or angiotensin-receptor blockers (68% vs. 40%) and diuretics (63% vs. 14%); both p < 0.05. However, the proportion of patients taking other medications was similar in the control and CHF groups: antiplatelet agents 83% and 89%, beta-blockers 77% and 53%, statins 91% and 89%, and antianginal agents (nitrates, calcium antagonists) 89% and 68%, respectively.
Inflammatory markers.
The CRP levels were significantly higher in CHF patients than in control subjects and correlated with clinical severity of heart failure as assessed by New York Heart Association (NYHA) functional class, even after adjusting for diabetes and renal failure (Figs. 1A and 1B). The TNF- and IL-6 levels tended to be higher in the CHF group, but did not achieve significance (Figs. 1C and 1D). There was a significant positive correlation between IL-6 and CRP levels (r = 0.627; p < 0.0001), as expected.
View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 1 Plasma Levels of Inflammatory Markers CRP, IL-6, and TNF- in Subjects With or Without Heart Failure
(A) C-reactive protein (CRP) levels in control versus heart failure groups; *p < 0.05 by Mann-Whitney test. (B) CRP levels by New York Heart Association (NYHA) functional class. The linear regression was adjusted for diabetes and renal failure. (C) Interleukin (IL)-6 levels. (D) Tumor necrosis factor (TNF)- levels.
|
|
Vasomotor function.
Mean vasodilator responses to acetylcholine and to SNP were not significantly different between the 2 patient groups as a whole using nonlinear regression (Figs. 2A and 2B), but both varied markedly among patients in each group. To assess endothelium-dependent relaxation relative to the smooth muscle response to nonendothelial NO per se (i.e., SNP), we normalized the maximal acetylcholine response by the maximal SNP response in each ring. Figure 2C shows that the relative endothelium-dependent relaxation was significantly lower in CHF compared with control subjects. This difference remained significant if patients with diabetes were excluded (37.2 ± 8.8% vs. 17.0 ± 4.7% control vs. CHF, respectively; p < 0.05).
View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 2 Vasomotor Function in Saphenous Vein Segments From Control and Heart Failure Groups
(A) Mean concentration-response relationship for acetylcholine (ACh). (B) Mean concentration-response relationship for sodium nitroprusside (SNP). (C) Relative endothelial-dependent relaxation (maximum response to ACh normalized by the maximal response to SNP). *p < 0.05 by Mann-Whitney test.
|
|
Vascular ROS.
Superoxide generation was significantly greater in saphenous veins of CHF patients compared with control subjects (Fig. 3A) and remained greater in the CHF group after exclusion of diabetics (2.1 ± 0.3 ILU vs. 4.5 ± 0.7 ILU control vs. CHF, respectively; p < 0.05). There was a significant correlation between the level of superoxide production and NYHA functional class by linear regression (p = 0.0001) (Fig. 3B), which was independent of diabetes or renal failure. However, we did not find a significant correlation between superoxide generation and EF or endothelial-dependent relaxation (data not shown). Superoxide production in both groups was virtually inhibited by DPI or Tiron but unaffected by L-NAME, allopurinol, or rotenone (Fig. 3C), consistent with Nox being the main source.
View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 3 Superoxide Production by Human Saphenous Veins From Patients With and Without Heart Failure
(A) Superoxide production by lucigenin-enhanced chemiluminescence. *p < 0.05 by Mann-Whitney test. (B) Relationship between superoxide and New York Heart Association (NYHA) functional class using a linear regression model adjusted for diabetes and renal failure. *p < 0.05. (C) Effect of various inhibitors on superoxide production in the control and heart failure groups. *p < 0.05 by analysis of variance followed by Scheffe test, to test for differences among interventions in either the control group or the heart failure group. DPI = diphenyleneiodonium; L-NAME = NG-nitro-L-arginine methyl ester. (D) Relationship between superoxide and C-reactive protein (CRP) levels; Pearson correlation: r = 0.501; p < 0.05.
|
|
We investigated potential factors responsible for the increased superoxide levels using a multiple logistic regression model with superoxide production as the dependent variable and NYHA functional class, CRP, renal failure, diabetes, hypertension, and hypercholesterolemia as covariates. Only NYHA functional class and CRP levels correlated with superoxide (p < 0.005; n = 32). Figure 3D shows the correlation between CRP levels and vascular superoxide.
Expression of Nox subunits and eNOS.
To investigate the possible contributors to increased saphenous vein Nox activity, we analyzed messenger ribonucleic acid (mRNA) expression of the oxidase catalytic subunits Nox1, Nox2, and Nox4 and the regulatory subunits p47phox and p67phox. The Nox4 expression was significantly higher in the CHF compared with control group, and Nox2 tended to be higher but not significantly (Figs. 4A and 4B). The Nox1 expression was below the level of detection in virtually all patients in both groups. The level of p67phox expression was significantly higher in the CHF compared with the control group, whereas p47phox levels were similar in the 2 groups (Figs. 4C and 4D). We found no difference in eNOS mRNA expression level between the 2 groups (data not shown).
View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 4 Expression of Nox Isoforms by Real-Time Polymerase Chain Reaction in Human Saphenous Veins From Patients With and Without Heart Failure
(A) Nox2 expression; (B) Nox4 expression; (C) p47phox expression; (D) p67phox expression. *p < 0.05 by unpaired Student t test. mRNA = messenger ribonucleic acid; Nox = nicotinamide adenine dinucleotide phosphate oxidase.
|
|
|
Discussion
|
|---|
Impaired endothelium-dependent vasorelaxation has been demonstrated in many arterial vascular beds in vivo in patients with CHF and contributes to several aspects of disease pathophysiology (1,2). A reduction in NO bioavailability secondary to increased inactivation by superoxide is a major etiologic factor in this dysfunction, but the ROS sources that are responsible in human CHF remain incompletely understood. In the present study, we found that relative endothelial-dependent relaxation was impaired in veins of CHF patients compared with control subjects, analogous to previous findings in arterial beds. More importantly, the endothelial dysfunction was associated with an increase in Nox-derived superoxide generation, which was accompanied by increased expression of the Nox4 isoform and the oxidase regulatory subunit p67phox and was correlated with elevated CRP levels, suggesting that it may be driven by inflammatory activation.
Several ROS sources may potentially contribute to endothelial dysfunction in CHF, including xanthine oxidase, uncoupled NOS, Nox, and mitochondria (9). In the experimental setting, increased Nox-derived ROS generation is involved in the development of endothelial dysfunction in many different conditions (9,10) and has been implicated in experimental heart failure (11,12). Recent in vivo studies in CHF patients provide quite good evidence that xanthine oxidase-derived ROS may contribute to endothelial dysfunction in the forearm arterial bed (7,8), but a possible role of Nox was not investigated. Interestingly, increased Nox-derived ROS not only contribute directly to endothelial dysfunction but may also play a key role in triggering further ROS production through the conversion of xanthine dehydrogenase to xanthine oxidase and the uncoupling of NOS secondary to oxidative degradation of the cofactor tetrahydrobiopterin (9). Therefore, an initial increase in Nox-derived ROS may be a key factor driving ROS production by other sources. In the present study, we found clear evidence of increased Nox activity in saphenous veins of CHF patients compared with control subjects. The NADPH-dependent ROS generation was inhibited by DPI but not by inhibitors of NOS, xanthine oxidase, or mitochondrial complex I, consistent with Nox as the source. We also noted a progressive increase in Nox activity with increasing NYHA functional class.
The potential mechanisms that may activate Nox are important to elucidate to understand why and how it contributes to endothelial dysfunction in CHF. Human CHF is well recognized to be associated with elevated inflammatory markers such as CRP, IL-6, and TNF-, and the levels of these markers correlate with NYHA functional class, hospitalization rate, and survival (16). Cytokines such as TNF- may be involved in the pathogenesis of endothelial dysfunction by modulating the balance between production of NO and vasoconstrictors (17), but are also potent activators of vascular Nox (15,18). C-Reactive protein is also reported to have direct effects on endothelial function by enhancing Nox-derived superoxide generation (19). In the present study, we confirmed that CRP levels were significantly elevated in CHF patients, with a similar trend for IL-6 and TNF-. More importantly, there was a strong and independent correlation between CRP levels and Nox activity, suggesting that inflammatory mechanisms may be responsible for activating Nox in CHF.
The Nox isoforms are now well recognized as major ROS sources involved in the genesis of endothelial dysfunction as well as pathological redox signaling in many diseases (9). The prototypic Nox first described in neutrophils contains a Nox2 (or gp91phox) subunit which is responsible for catalyzing electron transfer from NADPH to molecular O2, thereby generating superoxide (20). The active Nox2 oxidase complex contains not only Nox2 and its partner subunit p22phox but also several regulatory subunits (p47phox, p67phox, Rac), whose association with the oxidase is required for its activation; p67phox is essential for oxidase activation. The Nox2 isoform is now known to be expressed also in the endothelium, adventitial fibroblasts, and inflammatory cells (9). Recently, other distinct Nox isoforms each encoded by separate genes have been described, among which Nox1 and Nox4 are thought to be important in the vasculature, the former mainly in rodent vessels (20). Both Nox2 and Nox4 are expressed in human vessels, and we found that Nox4 mRNA levels were significantly elevated in the CHF group. Interestingly, Nox4 activity is thought to be regulated largely at a transcriptional level (20), suggesting that the elevated mRNA levels may contribute to increased ROS generation. The Nox4 activity has also been reported to be increased by inflammatory stimuli such as lipopolysaccharide (21). In contrast to Nox4, Nox2 is largely activated by the regulatory subunits p47phox and p67phox, with the latter being directly implicated in activation (20). It is therefore notable that we found a significant increase in p67phox levels, which could contribute to increased Nox2 oxidase activity. The Nox2 levels also tended to be elevated but not significantly, whereas the level of Nox1 was very low.
Earlier human studies reported a role of Nox-derived ROS in endothelial dysfunction in patients with coronary artery disease and diabetes as well as an association with risk factors for coronary disease (22,23). Although all subjects in the present study had coronary artery disease and most had at least 1 risk factor for atherosclerosis, the groups with and without CHF were well matched for these factors, apart from diabetes which was more prevalent in the CHF group. However, the relationship between superoxide production and heart failure was found to be independent of diabetes, and the difference between groups remained after exclusion of patients with diabetes. In multiple regression analysis, CRP and NYHA functional class were the only independent factors that correlated with superoxide production. It is worth noting that the majority of subjects studied were receiving medications, namely, statins and antagonists of the renin-angiotensin system, that are known to reduce Nox activity and improve endothelial function (9). Therefore, it is possible that the levels of superoxide could be higher and endothelial dysfunction even worse in CHF patients not on these drugs. However, it should also be noted that numerous factors, including several that reduce NO production, may be involved in endothelial dysfunction, so that the current findings do not exclude a role for such factors.
In summary, the present study indicates for the first time that increased Nox activity contributes to elevated superoxide production and vascular endothelial dysfunction in human CHF and suggests that increased inflammatory activation may be an etiologic factor. Because the present study was undertaken in saphenous veins, determining whether there is a similar increase in Nox activity in arteries would require direct investigation. However, earlier work suggested that there was a close correlation between arterial and venous Nox expression in humans, possibly because of common systemic influences (24). The present results suggesting that inflammatory activation may drive the changes in superoxide production are consistent with this idea. Although no direct comment can be made about the arterial circulation, venous endothelial dysfunction may be important in the pathophysiology of human CHF by regulating venous capacitance, venous return, and ventricular preload (4,25).
|
Footnotes
|
|---|
Supported by EU FP6 grant LSHM-CT-2005-018833, EUGeneHeart; British Heart Foundation grant CVH/99001; and National Institute for Health Research (NIHR) comprehensive Biomedical Research Centre award to Guy’s and St. Thomas’ National Health Service Foundation Trust in partnership with King’s College London and King’s College Hospital NHS Foundation Trust. Dr. Dworakowski was a visiting European Society of Cardiology Fellow from I Department of Cardiology, Medical University of Gdansk, Gdansk, Poland.
|
References
|
|---|
1. Kubo SH, Rector TS, Bank AJ, Williams RE, Heifetz SM. Endothelium-dependent vasodilation is attenuated in patients with heart failure Circulation 1991;84:1589-1596.[Abstract/Free Full Text]2. Drexler H, Hayoz D, Munzel T, Just H, Zelis R, Brunner HR. Endothelial function in congestive heart failure Am Heart J 1993;126:761-764.[CrossRef][Web of Science][Medline] 3. Ogilvie RI, Zborowska-Sluis D. Effect of chronic rapid ventricular pacing on total vascular capacitance Circulation 1992;85:1524-1530.[Abstract/Free Full Text] 4. Nightingale AK, Blackman DJ, Ellis GR, et al. Preservation of venous endothelial function in the forearm venous capacitance bed of patients with chronic heart failure despite arterial endothelial dysfunction J Am Coll Cardiol 2001;37:1062-1068.[Abstract/Free Full Text] 5. Heitzer T, Baldus S, von Kodolitsch Y, Rudolph V, Meinertz T. Systemic endothelial dysfunction as an early predictor of adverse outcome in heart failure Arterioscler Thromb Vasc Biol 2005;25:1174-1179.[Abstract/Free Full Text] 6. Hornig B, Arakawa N, Kohler C, Drexler H. Vitamin C improves endothelial function of conduit arteries in patients with chronic heart failure Circulation 1998;97:363-368.[Abstract/Free Full Text] 7. Landmesser U, Spiekermann S, Dikalov S, et al. Vascular oxidative stress and endothelial dysfunction in patients with chronic heart failure: role of xanthine-oxidase and extracellular superoxide dismutase Circulation 2002;106:3073-3078.[Abstract/Free Full Text] 8. Farquharson CA, Butler R, Hill A, Belch JJ, Struthers AD. Allopurinol improves endothelial dysfunction in chronic heart failure Circulation 2002;106:221-226.[Abstract/Free Full Text] 9. Li JM, Shah AM. Endothelial cell superoxide generation: regulation and relevance for cardiovascular pathophysiology Am J Physiol Regul Integr Comp Physiol 2004;287:R1014-R1030.[Abstract/Free Full Text] 10. Paravicini TM, Touyz RM. Redox signaling in hypertension Cardiovasc Res 2006;71:247-258.[Abstract/Free Full Text] 11. Widder J, Behr T, Fraccarollo D, et al. Vascular endothelial dysfunction and superoxide anion production in heart failure are p38 MAP kinase-dependent Cardiovasc Res 2004;63:161-167.[Abstract/Free Full Text] 12. Mollnau H, Oelze M, August M, et al. Mechanisms of increased vascular superoxide production in an experimental model of idiopathic dilated cardiomyopathy Arterioscler Thromb Vasc Biol 2005;25:2554-2559.[Abstract/Free Full Text] 13. Heymes C, Bendall JK, Ratajczak P, et al. Increased myocardial NADPH oxidase activity in human heart failure J Am Coll Cardiol 2003;41:2164-2171.[Abstract/Free Full Text] 14. Momin AU, Melikian N, Shah AM, et al. Leptin is an endothelial-independent vasodilator in humans with coronary artery disease: evidence for tissue specificity of leptin resistance Eur Heart J 2006;27:2294-2299.[Abstract/Free Full Text] 15. Li JM, Mullen AM, Yun S, et al. Essential role of the NADPH oxidase subunit p47phox in endothelial cell superoxide production in response to phorbol ester and tumor necrosis factor- Circ Res 2002;90:143-150.[Abstract/Free Full Text] 16. Yndestad A, Damas JK, Oie E, Ueland T, Gullestad L, Aukrust P. Systemic inflammation in heart failure—the whys and wherefores Heart Fail Rev 2006;11:83-92.[CrossRef][Web of Science][Medline] 17. Tousoulis D, Charakida M, Stefanadis C. Endothelial function and inflammation in coronary artery disease Heart 2006;92:441-444.[Abstract/Free Full Text] 18. Frey RS, Rahman A, Kefer JC, Minshall RD, Malik AB. PKCzeta regulates TNF-alpha-induced activation of NADPH oxidase in endothelial cells Circ Res 2002;90:1012-1019.[Abstract/Free Full Text] 19. Qamirani E, Ren Y, Kuo L, Hein TW. C-Reactive protein inhibits endothelium-dependent NO-mediated dilation in coronary arterioles by activating p38 kinase and NAD(P)H oxidase Arterioscler Thromb Vasc Biol 2005;25:995-1001.[Abstract/Free Full Text] 20. Bedard K, Krause KH. The Nox family of ROS-generating NADPH oxidases: physiology and pathophysiology Physiol Rev 2007;87:245-313.[Abstract/Free Full Text] 21. Park HS, Chun JN, Jung HY, Choi C, Bae YS. Role of NADPH oxidase 4 in lipopolysaccharide-induced proinflammatory responses by human aortic endothelial cells Cardiovasc Res 2006;72:447-455.[Abstract/Free Full Text] 22. Guzik TJ, West NE, Black E, et al. Vascular superoxide production by NAD(P)H oxidase: association with endothelial dysfunction and clinical risk factors Circ Res 2000;86:E85-E90.[Web of Science][Medline] 23. Spiekermann S, Landmesser U, Dikalov S, et al. Electron spin resonance characterization of vascular xanthine and NAD(P)H oxidase activity in patients with coronary artery disease: relation to endothelium-dependent vasodilation Circulation 2003;107:1383-1389.[Abstract/Free Full Text] 24. Guzik TJ, Sadowski J, Kapelak B, et al. Systemic regulation of vascular NAD(P)H oxidase activity and nox isoform expression in human arteries and veins Arterioscler Thromb Vasc Biol 2004;24:1614-1620.[Abstract/Free Full Text] 25. Blackman DJ, Morris-Thurgood JA, Atherton JJ, et al. Endothelium-derived nitric oxide contributes to the regulation of venous tone in humans Circulation 2000;101:165-170.[Abstract/Free Full Text]
Related Article
-
Inside This Issue of JACC
J. Am. Coll. Cardiol. 2008 51: A33-A34.
[Full Text]
[PDF]
|
Top
Abstract
Methods