Advertisement






Click here for more guidelines.
CME Topic Collections Past Issues Search Current Issue Home
     

J Am Coll Cardiol, 2007; 50:1884-1893, doi:10.1016/j.jacc.2007.07.054 (Published online 22 October 2007).
© 2007 by the American College of Cardiology Foundation
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
j.jacc.2007.07.054v1
50/19/1884    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (37)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Caspi, O.
Right arrow Articles by Gepstein, L.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Caspi, O.
Right arrow Articles by Gepstein, L.
Related Collections
Right arrowRelated Article

PRECLINICAL STUDY

Transplantation of Human Embryonic Stem Cell-Derived Cardiomyocytes Improves Myocardial Performance in Infarcted Rat Hearts

Oren Caspi, MD*, Irit Huber, PhD*, Izhak Kehat, MD, PhD*,{dagger}, Manhal Habib, MD*, Gil Arbel, MSc*, Amira Gepstein, PhD*, Lior Yankelson, MD*, Doron Aronson, MD{dagger}, Rafael Beyar, MD, PhD{dagger} and Lior Gepstein, MD, PhD*,{dagger},*

* Sohnis Family Research Laboratory for Cardiac Electrophysiology and Regenerative Medicine, the Rappaport Family Institute for Research in the Medical Sciences, Technion-Israel Institute of Technology, Haifa, Israel
{dagger} Cardiology Department, Rambam Medical Center, Haifa, Israel.

Manuscript received March 5, 2007; revised manuscript received July 26, 2007, accepted July 30, 2007.

* Reprint requests and correspondence: Dr. Lior Gepstein, Technion’s Faculty of Medicine, P.O. Box 9649, Haifa, 31096, Israel. (Email: mdlior{at}tx.technion.ac.il).


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Objectives: We evaluated the ability of human embryonic stem cells (hESCs) and their cardiomyocyte derivatives (hESC-CMs) to engraft and improve myocardial performance in the rat chronic infarction model.

Background: Cell therapy is emerging as a novel therapy for myocardial repair but is hampered by the lack of sources for human cardiomyocytes.

Methods: Immunosuppressed healthy and infarcted (7 to 10 days after coronary ligation) rat hearts were randomized to injection of undifferentiated hESCs, hESC-CMs, noncardiomyocyte hESC derivatives, or saline. Detailed histological analysis and sequential echocardiography were used to determine the structural and functional consequences of cell grafting.

Results: Transplantation of undifferentiated hESCs resulted in the formation of teratoma-like structures. This phenomenon was prevented by grafting of ex vivo pre-differentiated hESC-CMs. The grafted cardiomyocytes survived, proliferated, matured, aligned, and formed gap junctions with host cardiac tissue. Functionally, animals injected with saline or nonmyocyte hESC derivatives demonstrated significant left ventricular (LV) dilatation and functional deterioration, whereas grafting of hESC-CMs attenuated this remodeling process. Hence, post-injury baseline fractional shortening deteriorated by 50% (from 20 ± 2% to 10 ± 2%) and by 30% (20 ± 2% to 14 ± 2%) in the saline and nonmyocyte groups while improving by 22% (21 ± 2% to 25 ± 3%) in the hESC-CM group. Similarly, wall motion score index and LV diastolic dimensions were significantly lower in the hESC-CM animals.

Conclusions: Transplantation of hESC-CMs after extensive myocardial infarction in rats results in the formation of stable cardiomyocyte grafts, attenuation of the remodeling process, and functional benefit. These findings highlight the potential of hESCs for myocardial cell therapy strategies.

Abbreviations and Acronyms
  eGFP = enhanced green fluorescent protein
  FS = fractional shortening
  hESC = human embryonic stem cell
  hESC-CM = human embryonic stem cell–derived cardiomyocyte
  HLA = human leukocyte antigen
  LAD = left anterior descending coronary artery
  LV = left ventricle/ventricular
  LVDd = left ventricular end-diastolic diameter
  MLC-2a = myosin light chain-2a
  PCR = polymerase chain reaction
  Tn = troponin


The adult heart lacks effective repair mechanisms, and, therefore, any significant cell loss, such as occurs during myocardial infarction, may lead to the development of progressive heart failure. Cell therapy and tissue engineering are emerging as novel therapeutic paradigms for myocardial repair (1,2). Cardiomyocyte transplantation (derived from fetal or neonatal rat heart tissue or from mouse embryonic stem cells) was associated with smaller infarcts (3,4), prevented cardiac dilatation and remodeling (5), and even improved myocardial performance (6). Clinical translation of these promising strategies is hampered, however, by the lack of cell sources for human cardiac tissue.

A possible solution to the aforementioned cell-sourcing problem may be the recently described human embryonic stem cell (hESC) lines (7). These unique cells have the capacity for prolonged undifferentiated proliferation in culture while maintaining the potential to differentiate into derivatives of all 3 germ layers. Recently, using the embryoid body (EB) differentiating system, we and others established a reproducible cardiomyocyte differentiation system from the hESC (8–11). Cells isolated from the contracting EBs demonstrated molecular, structural, and functional properties of early-stage human cardiomyocytes (8–14). More recently the ability of the human embryonic stem cell–derived cardiomyocytes (hESC-CMs) to survive (15) and integrate structurally and functionally with healthy host cardiac tissue, both in vitro (in coculturing studies) and in vivo (by pacing the heart in an animal model of slow heart rate), was demonstrated (16,17).

In the current study, we continued to explore the possible role of this unique tissue for myocardial repair in diseased hearts. Specifically, our aims were 3-fold: 1) to determine whether existing heart tissue can provide the appropriate environment to augment cardiomyocyte differentiation of undifferentiated hESC; 2) to determine the ability of ex vivo-differentiated hESC-CMs to survive, proliferate, and integrate with host tissue after grafting into the uninjured and infarcted rat heart; and 3) to assess the ability of cell grafting to improve myocardial performance in this model.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
In vitro hESC cardiomyocyte differentiation.   Undifferentiated hESCs (H9.2-clone) were propagated on mouse embryonic fibroblast feeder layer as previously described (8). To induce differentiation, hESCs were dispersed to small clumps using collagenase-IV 1 mg/ml (Gibco, Invitrogen, Carlsbad, California) and cultured in suspension for 7 to 10 days. The generated EBs were plated on gelatin-coated plates and observed for the appearance of spontaneous contractions. For the transplantation studies, the contracting areas (30 to 45 days of differentiation) were microdissected and dissociated into small clusters (20 to 100 cells) with collagenase-B (1 mg/ml) (Roche, Basel, Switzerland).

To identify the transplanted cells, we used a number of labeling, staining, and tracking techniques: 1) labeling with the fluorescent cell tracer Vybrant-carboxyfluorescein diacetate, succinimidyl ester (25 µmol/l, Molecular Probes, Invitrogen); 2) tagging with genetic markers: enhanced green fluorescent protein (eGFP) and nLacZ expression was achieved using lentiviral transduction and electroporation (Nucleofector program-A23 and V-transfection solution), respectively; and 3) immunostaining for human-specific antigens.

Effect of pre-existing cardiac environment on hESC differentiation.   All animal studies were approved by the Animal Board and Safety Committee of the Technion Faculty of Medicine. Primary cultures of neonatal rat ventricular myocytes (density 1.5 x 106 cells/ml) were prepared as previously described (16). Early-stage EBs (2 to 5 days in suspension) were labeled with CM-DiI (Molecular Probes), added to the rat cultures, and followed for 4 weeks.

To assess for the effect of the in vivo cardiac environment, we injected 3 x 106 undifferentiated hESCs into the uninjured and infarcted rat left ventricular (LV) myocardium. The hearts were harvested 4 weeks later.

Cell transplantation.   Male Sprague-Dawley rats (250 to 300 g) were anesthetized (ketamine/xylasine), intubated, and ventilated. After left thoracotomy, the proximal left anterior descending coronary artery (LAD) was ligated. A second thoracotomy was performed 7 to 10 days later, and cells were transplanted to the infarcted area at 4 different sites. Three groups were studied: 1) a control group in which saline (300 µl) was injected (n = 8); 2) a group in which 1.5 x 106 noncardiomyocyte hESC derivatives were grafted (n = 9); these cells were derived from noncontracting differentiating EBs and represent a heterogeneous population of early stage differentiating cells of different lineages (18), most of which are epithelial-like cells; and 3) a group in which 1.5 x 106 hESC-CMs (n = 8) were transplanted. To prevent graft rejection, animals from all groups were treated with cyclosporine A (15 mg/kg/day) and methylprednisolone (2 mg/kg/day).

Histological examination.   The hearts were harvested at 36 h to 8 weeks after grafting, frozen in liquid nitrogen, and cryo-sectioned (8-µm sections). Immunostaining was performed using monoclonal antibodies to human-mitochondria antigens, troponin I (TnI), Ryanodine, Cx43 (all from Chemicion, Temecula, California), humanKi-67, (DakoCytomation, Glostrup, Denmark), TRA1-60 and TRA1-81 (Hybridoma Bank, Iowa City, Iowa), Oct-4 (Santa Cruz, Santa Cruz, California), sarcomeric {alpha}-actinin (Sigma), and human-human leukocyte antigen (HLA)-A,B,C antigens (BD-Pharmingen, Franklin Lakes, New Jersey), or polyclonal antibodies to eGFP (MBL, Woods Hole, Massachusetts) and collagen types I and III (Southern Biotech, Birmingham, Alabama). Preparations were incubated with secondary antibodies at 1:100 dilutions and analyzed by confocal microscopy (Nikon and Bio-Rad scanning system, Hercules, California).

Polymerase chain reaction (PCR) analysis.   The presence of human cells within the rat hearts was evaluated using PCR-based deoxyribonucleic acid (DNA) amplification of the {alpha}-satellite region of the human chromosome 17. Hearts were frozen in liquid nitrogen and homogenized with Polytron (Kinematica, Newark, New Jersey). Genomic DNA was produced using Easy-DNA-Kit (Invitrogen). Polymerase chain reaction was carried out using Red-Load-Taq-Master-Mix (LAROVA, Teltow, Germany). The forward primer was GGGATAATTTCAGCTGACTAAACAG, and the reverse primer was GTGTTTCATAGCTGCTCTTTCCA.

Laser microdissection and reverse transcription PCR analysis.   Cryo-sectioned slices (20 µm) containing the transplanted nLacZ-expressing cells were stained with 1% Cresylviolet, dehydrated, and frozen in –80°C. Slides were evaluated for beta-Galactosidase activity using LacZ reporter kit (Invitrogen). Laser capture microdissection (P.A.L.M. Microlaser Technologies, Bernreid, Germany) was performed to isolate the positively stained cells. Ribonucleic acid (RNA) was isolated from these cells using the RNA easy microkit (Qiagen, Hilden, Germany), and reverse transcription into complementary DNA was performed using Reverse-iT-1st-Strand-Synthesis Kit (ABgene, Epsom, United Kingdom). Polymerase chain reaction for myosin light chain-2a (MLC-2a) was executed using 1U Taq-DNA polymerase (PeqLab, Erlangen, Germany). The forward primer was AAGGTGAGTGTCCCAGAGG, and the reverse primer was ACAGAGTTTATTGAGGTGCCC.

Echocardiography.   Transthoracic echocardiography was performed 5 to 7 days after coronary ligation and 30 to 60 days after cell grafting, using the GE-Vivid3 system (10-MHz transducer, GE Healthcare, Haifa, Israel). The following parameters were measured: 1) maximal left ventricular end-diastolic (LVDd) and end-systolic dimensions; 2) wall motion score (1 = normal, 2 = hypokinesia, 3 = akinesia, 4 = dyskinesia, and 5 = aneurismal dyskinesis); and 3) fractional shortening (FS) was calculated as: FS (%) = [(LVDd–)/LVDd] x 100. All measurements were averaged for 3 cardiac cycles and performed by an experienced operator blinded to the treatment group.

Statistical analysis.   Data are expressed as mean ± standard error of the mean or median and interquartile range. The Kolmogorov-Smirnov procedure was applied to determine whether the data were normally distributed. A general linear model 2-way repeated-measures analysis of variance (ANOVA) was used to test the hypothesis that changes in measures of LV function over time varied among the 3 experimental groups. The model included the effects of treatment, time, and treatment-by-time interaction. The Bonferroni correction was used to assess significance of predefined comparisons at specific time points. Lung-tibia ratio data were not normally distributed. Therefore, groups were compared with the nonparametric 1-way ANOVA (Kruskal-Wallis test) followed by the Mann-Whitney test with Bonferroni correction.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Cardiac environment does not enhance hESC cardiomyogenesis.   One of the obstacles in using hESC for myocardial repair is the relatively low cardiomyocyte yield during spontaneous in vitro differentiation (19). Therefore, we tested the hypothesis that the existing cardiac tissue environment may provide the necessary signals to augment cardiomyocyte differentiation. To test this assumption, 726 fluorescently labeled early stage differentiating EBs were cocultured with primary cultures of neonatal rat ventricular myocytes (n = 5). Identical populations of early stage EBs were plated on gelatin-covered plates (spontaneous differentiation). In contrast to our initial assumption, the percentage of EBs containing contracting areas was found to be significantly lower (p < 0.01) in the coculturing group (0.7% of the 726 EBs studied) when compared with that in the control group (9.9% of 621 EBs).

We next evaluated the possible effects of the in vivo cardiac environment on hESC differentiation. Undifferentiated hESCs were grafted into the LV myocardium of healthy and infarcted cyclosporine-immunosuppressed rats. Histological examination, 4 weeks later, demonstrated that not only that the in vivo cardiac environment did not enhance hESC cardiomyogenesis (as assessed by immunostainings for cardiac-specific markers), but also that it resulted in almost no differentiation into the cardiac lineage in all hearts studied. Rather, in 6 of 10 healthy and in 3 of 6 infarcted rats, injection of undifferentiated hESCs resulted in the formation of teratoma-like structures, characterized by the presence of advanced cell derivatives of all 3 germ layers (Fig. 1A). In the rest of the hearts, either the transplanted cells could not be detected or they showed a more limited differentiation pattern, mostly to epithelial-like cell derivatives (data not shown).


Figure 1
View larger version (90K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1 In Vivo Transplantation of Undifferentiated hESC Results in Teratoma-Like Structures

(A) Hematoxilin and eosin staining of a teratoma within the infarcted area. Note the presence of early stage hyaline cartilage (right, top) and gastrointestinal-like columnar epithelium (right, bottom). (bars: left 500 µm, middle 200 µm, right 100 µm). (B) Immunostaining for the pluripotent markers Tra-1-60 (top) and Tra-1-81 (bottom). Note the positive staining of undifferentiated human embryonic stem cell (hESC) colonies (left) and the absence of staining in cells isolated from the contracting embryoid bodies (EBs) (right) (bar: 100 µm). (C) Troponin I immunostaining of cells isolated from the contracting EBs (bar: 60 µm).

 
In vivo grafting of the hESC-CMs into the uninjured heart.   Because grafting of undifferentiated hESCs resulted in the formation of teratoma-like structures, we pursued an alternative track of initial ex vivo differentiation of the hESC into the cardiac lineage followed by in vivo grafting of the hESC-CMs. Using our previously described EB differentiating system (8), we mechanically dissected the beating areas within the EBs (each containing approximately 6,000 cells), dispersed them into small clusters, and grafted them into the LV myocardium. To characterize the nature of the grafted cells before transplantation, we performed in vitro immunocytostaining studies of samples of these beating clusters (Figs. 1B and 1C). Immunostaining for undifferentiated hESC markers (Tra-1-60, Tra-1-81, and Oct-4 [not shown]) failed to show any positively stained cells (Fig. 1B). In contrast, 71 ± 4% of the cells stained positively for TnI (Fig. 1C).

Histological evaluation, conducted at 36 h and 4 weeks after hESC-CM transplantation revealed the presence of the grafted cells and lack of teratoma formation (Fig. 2). To assure the accurate identification of the grafted cells throughout this study, we used a number of labeling, tracking, and staining techniques. These included immunostaining for human-specific markers (using antimitochondrial [Fig. 2A], anti-HLA-A,B,C [Fig. 3C], and anti-Ki67 [Fig. 2D] antibodies, introduction of genetic markers eGFP [Figs. 2B, 2C, and 2E and Figs. 3A and 3B] or nLacZ [Figs. 4B and 4C]), and prelabeling with fluorescent cell tracers (Figs. 2F and 3D).


Figure 2
View larger version (92K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2 Transplantation of hESC-CMs in the Healthy Heart

(A) The transplanted area was localized by coinjection of 2-µm fluorescent beads (green), and the grafted cells were identified by immunostaining with antihuman mitochondria antibodies (red) (bar: 50 µm). (B) (Left) Hematoxilin and eosin staining depicting a cluster of grafted human embryonic stem cell-derived cardiomyocytes (hESC-CMs) (arrows). (Right) Immunostaining of the boxed area. In this example, enhanced green fluorescent protein-expressing hESC-CMs were used and were identified as yellow cells containing both troponin I (red) and enhanced green fluorescent protein (green) immunosignals. HC = human cardiomyocytes; R = rat (bar: 100 µm). (C) Immunostaining with antisarcomeric {alpha}-actinin (red) and antienhanced green fluorescent protein (green, right) antibodies. At this stage (36 h), the grafted hESC-CMs (arrows) displayed an immature, striated pattern (bar: 12 µm). (D) Assessment of the proliferation capacity of the hESC-CMs (36 h post-grafting) using antihuman Ki-67 (green) and antitroponin I (red) antibodies (bar: 10 µm). (E) (Left) Immunostaining of the grafted area (30 days post-transplantation) using antisarcomeric {alpha}-actinin (red) and anti-Cx43 (white) antibodies. (Right) Superposition of the immunostaining results with antienhanced green fluorescent protein (green) antibodies. Note the relatively organized sarcomeric pattern (bar: 20 µm). (F) Immunostaining of the transplanted fluorescently labeled (yellow) hESC-CMs with anti-Ryanodine antibodies. Nuclei are counterstained with To-Pro3 (blue) in all immunofluorescent images.

 

Figure 3
View larger version (94K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3 Transplantation of hESC-CMs in the Infarcted Heart

(A) Identification of the grafted hESC-CMs at the scar’s center using antienhanced green fluorescent protein (green, left) and antisarcomeric {alpha}-actinin (red, middle) antibodies. (Right) Superposition of both images. The scar was identified using anticollagen antibodies (blue) (bar: 80 µm). (B) Immunostainings of the transplanted hESC-CMs at the infarct border zone using antienhanced green fluorescent protein (green) and antitroponin I (red, right) antibodies (bar: 75 µm). (C) Identification of the grafted hESC-CMs with antihuman-human leukocyte antigen antibodies. (Top) Immunohistochemistry results (bar: 100 µm). (Bottom) Immunofluorescent staining using antihuman-human leukocyte antigen (green) and antitroponin I (red) antibodies (bar: 75 µm). (D) Development of gap junctions (Cx43 immunostaining, white) between the grafted cells (prelabeled with Vybrant-CFDA) (green, left) and host cardiomyocytes (arrows). Cardiomyocytes were identified using antitroponin I antibodies (red, middle) (bar: 60 µm). Abbreviations as in Figure 2.

 

Figure 4
View larger version (66K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4 Long-Term Survival and Maintenance of Cardiac Phenotype of the Transplanted hESC-CMs

(A) Polymerase chain reaction-based deoxyribonucleic acid amplification using human-specific primers at various time points after transplantation. (B) Coimmunostaining with anti-LacZ (red) and antitroponin I (green) antibodies (bar: 100 µm). (C) The nLacZ-expressing cells (blue) were isolated using laser microdissection (shown before [left] and after [right] laser microdissection) (bar: 200 µm). (D) Myosin light chain-2a expression in the microdissected nLacZ-expressing cells, in a remote left ventricular (LV) site, and in a saline-injected heart. Contracting embryoid bodies served as positive controls. d = days; hESC-CMs = human embryonic stem cell-derived cardiomyocytes.

 
As shown in Figure 2, the cell grafts consisted of confluent masses of human cells interspersed within host myocardium. Histological examination, at 36 h post-transplantation (Figs. 2A to 2D), demonstrated that the engrafted hESC-CMs were relatively small, had a high nuclear/cytoplasmatic ratio, displayed an early striated pattern, and were arranged isotropically within the host myocardium. In 10 ± 2% of these human cardiomyocytes (251 of 2,404 cells examined in 4 hearts), we could find evidence for cell proliferation, as assessed by coimmunostaining for human Ki67 and TnI (Fig. 2D).

Four weeks after cell transplantation, we could still identify the grafted hESC-CMs. Although the cells remained relatively immature, the cell grafts appeared to be more organized and have undergone some ultrastructural maturation. The hESC-CMs were larger, their nucleus/cytoplasm ratio was lower, they demonstrated a more organized striated pattern (Fig. 2E), and they were stained positively with anti-Ryandine antibodies (indicating the presence of sarcoplasmatic reticulum) (Fig. 2F). This was coupled with a complete withdrawal from the cell cycle (negative Ki67 staining, data not shown). Similarly, Cx43 immunostaining demonstrated the development of gap junction by the engrafted cells (Fig. 2E).

In vivo engraftment in the infarcted rat heart.   The ability of the hESC-CMs to engraft also in the infarcted myocardium (7 to 10 days after coronary ligation) was assessed next. Histological evaluation of the hearts injected with the hESC-CMs (at 30 or 60 days) (Fig. 3) demonstrated the presence of the grafted cells and lack of teratoma formation. The grafted hESC-CMs were identified as confluent clusters of human cells that could be located occasionally in the center of the scar (Fig. 3A) but more commonly in the border zone (Figs. 3B to 3D). The cell grafts were demonstrated to align with host cells with no significant inflammatory encapsulation. Occasionally, gap junctions could be identified between host and grafted cells (Fig. 3D).

We next quantified the histological information to determine the relative size of the hESC-CM cell grafts within the infarcted area. This analysis was performed in 8 hearts (in each heart between 3 to 5 sections were examined). Initially, the infarcted area was identified using anticollagen antibodies. The viable cardiomyocyte area within this region was then determined by immunostaining for TnI. Finally, the fraction of this cardiomyocyte cellular area that was of human origin was quantified in coimmunostaining studies using the aforementioned labeling and staining techniques, used to identify the transplanted human cells. Our results show that 25 ± 6% of the infarct area was comprised of viable cardiac tissue of which 45 ± 12% was stained positive for human markers.

To verify and provide additional information regarding the survival and maintenance of the cardiomyocyte phenotype of the grafted hESC-CMs, we developed 2 assays. To evaluate for the presence of the human cells within the rat myocardium, we established a PCR assay for detecting human-specific DNA. Our results demonstrate the presence of the human cells immediately after cell grafting (1 h), and their survival at 1 and 8 weeks after cell transplantation (Fig. 4A). While these PCR studies do not provide quantitative information regarding the size of the graft, our preliminary calibration study demonstrated that a significant number of human cells (>100,000) are required for such a positive signal. In contrast, hearts injected with saline failed to show positive PCR signal (Fig. 4A).

We next performed additional experiments, in which the hESC-derived cell grafts were transfected to express nLacZ. Immunostaining analysis of the grafted area confirmed the survival of the nLacZ-expressing cells and their human cardiac phenotype (Fig. 4B). To establish the cardiomyocyte phenotype of the engrafted cells, beyond the histological examination, the nLacZ-expressing cells were carefully isolated for RNA analysis using laser microdissection (Fig. 4C). Reverse transcription PCR studies using a human-specific primer sequence for the MLC-2a gene (shown to be robustly expressed by the hESC-CMs in vitro but not detected in the rat LV myocardium) confirmed the expression of this gene by the transplanted human cells (Fig. 4D).

Functional assessment of cell grafting.   We next assessed the functional consequences of cell grafting. To this end, serial echocardiography measurements were performed in animals transplanted with hESC-CMs (n = 8) and were compared with those in control groups of animals injected with nonmyocyte hESC derivatives (n = 9) or saline (n = 8) (Figs. 5 and 6).Go These studies revealed that the 3 experimental groups differed with respect to changes in measures of LV function and remodeling over time (Fig. 6). The treatment-by-time interaction effect was significant for all echocardiographic parameters including FS, LVDd, and wall motion score index (all p < 0.001).


Figure 5
View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5 Functional Results After Cell Transplantation

(Top and middle) M-mode echocardiographic images demonstrating post-infarction remodeling with left ventricular dilatation and functional deterioration in the saline- and nonmyocyte transplantation groups, respectively. (Bottom) Similar images in the human embryonic stem cell (ESC)-derived cardiomyocyte grafting group. Note the absence of significant left ventricular dilatation (bar: 0.5 cm).

 

Figure 6
View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6 Functional Assessment of Cell Grafting

(A) Changes in fractional shortening in individual animals before (post-injury baseline) and 30 and 60 days after cell grafting. (B to D) Changes in the average fractional shortening (B), wall motion score index (C), and left ventricular end-diastolic diameter (D) values in the human embryonic stem cell (ESC)-derived cardiomyocytes (green), nonmyocyte (purple), and saline-injection (red) groups. (E) Comparison of the lung weight to tibia length ratio between the groups. The p values were Bonferroni-adjusted for 3 comparisons: *p < 0.05; {dagger}p < 0.01; {ddagger}p < 0.005. MI = myocardial infarction.

 
The saline injection control group displayed a typical course of post-infarction LV remodeling (Figs. 5 and 6). The FS of healthy rats (before LAD ligation) was around 45% to 50%. A few days after coronary occlusion (post-injury baseline), we noted an initial decrease in FS to 20 ± 2%. Fractional shortening continued to deteriorate to 13 ± 2% and 10 ± 2% at 30 and 60 days, respectively (Figs. 6A and 6B). This deterioration in FS and wall motion score index (Fig. 6C) was coupled with progressive LV diastolic dilatation (Fig. 6D).

Transplantation of noncardiomyocyte hESC derivatives did not change this remodeling process (Figs. 6A to 6D). Figure 5 depicts examples of serial M-mode images obtained over time in the 3 groups. Note in the animals injected with saline and noncardiomyocytes (Figs. 5A and 5B) that the typical akinesis of the anterior wall persisted throughout the study, and this was coupled with significant LV dilation and functional deterioration. Consequentially, no significant changes were noted in the echocardiographic parameters in the nonmyocyte group when compared with saline-injected group (Figs. 6A to 6D).

Grafting of hESC-CMs attenuated this remodeling course of scar expansion, LV dilation, and functional deterioration (Figs. 5 and 6). Note in the M-mode examples in Figure 5, the lack of LV dilation at 30 and 60 days in the hESC-CM transplanted animal. Consequentially, at 60 days, hESC-CM cell grafting was associated with a significant improvement in all measures of LV function including higher FS (Bonferroni-adjusted for 3 comparisons, p < 0.001), lower wall motion score index (Bonferroni-adjusted for 3 comparisons, p = 0.008), and lower LVDd (Bonferroni-adjusted for 3 comparisons, p = 0.03) when compared with animals injected with saline or noncardiomyocyte hESC derivatives (Figs. 6B to 6D).

The positive effect of hESC-CMs on LV functional status was translated to a clinical benefit. This was manifested by a significant reduction (p < 0.05) in the lung/tibia weight ratio (0.39 ± 0.03 g/cm) when compared with that in the saline-injected group (0.67 ± 0.11 g/cm, Bonferroni-adjusted for 3 comparisons, p = 0.04) (Fig. 6E). The latter parameter represents a quantitative measure for the degree of pulmonary congestion. Assessment of blood pressure, heart rate, and body surface electrocardiogram did not reveal significant changes between the groups, and we did not note any sustained arrhythmias in the transplanted animals.


    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
In this study, we assessed the potential role of hESC for myocardial repair. The main findings of the study are: 1) the adult and neonatal cardiac tissue does not provide the necessary environment to guide the differentiation of hESC into the cardiac lineage; moreover, grafting of undifferentiated hESCs into the in vivo rat heart resulted in the formation of teratoma-like structures; 2) grafting of ex vivo pre-differentiated hESC-CMs into the uninjured and infarcted heart did not result in the generation of teratomas, rather the engrafted cardiomyocytes were shown to survive, proliferate, and integrate with host cardiac tissue; and 3) transplantation of hESC-CMs can favorably affect the remodeling process and even improve myocardial performance in this rat model of permanent coronary occlusion and extensive myocardial infarction.

Tissue microenvironment is thought to play a major role in stem cell differentiation toward specific lineages. However, in contrast to our initial hypothesis, the neonatal and adult rat cardiac environment did not provide the necessary cues for hESC cardiomyogenesis both in vitro and in vivo. These results may suggest that a much earlier embryonic environment may be required for directing embryonic stem cells into the cardiac lineage. Experimental evidence from a number of developmental model organisms suggests that the primitive visceral endoderm may play a pivotal role in promoting cardiac fate induction in the adjacent early mesoderm (20). This concept was further strengthened by a recent study showing that a visceral endoderm-like cell line (END-2) can promote the cardiac differentiation of hESC (9).

Importantly, the fact that intramyocardial grafting of undifferentiated hESC resulted in the formation of teratomas, as also shown in the mouse embryonic stem cell model (21), underscores the need to establish cardiomyocyte selection protocols (22,23) or other strategies (3) that would ascertain the lack of any undifferentiated hESCs in future clinical cell transplantation procedures.

Because loss of cardiomyocytes plays a critical role in the development of heart failure, cardiomyogenesis has been the central aim of cardiac regenerative therapy (1). Our long-term histological data as well as the results of the assays developed to detect human DNA within the rat heart and to assess the continuous expression of cardiac-specific genes by the grafted cells demonstrate the long-term engraftment, survival, and integration of the hESC-CMs. Interestingly, we noted superior engraftment results at the scar’s periphery when compared with its center. This finding may be attributed to the lower initial number of injected cells at the center, to the greater technical difficulty in injecting cells in this much thinner region, and to the improved vascularization of the border zone.

Grafting of hESC-CMs ameliorated the typical infarct remodeling process of LV expansion and functional deterioration. Similar attenuation of the remodeling process in rodents was previously reported after delivery of a variety of cell types (1,2). The mechanism underlying the functional improvement in these studies may not necessarily involve the generation of new contractile elements (cardiomyocytes) and may be related to changes in the mechanical properties of the scar, recruitment of endogenous stem cells, and induction of angiogenesis.

While all of the aforementioned mechanisms probably play a role in the functional benefit observed after hESC-CMs transplantation, it is also possible that some of the observed effect may stem from direct contribution to contractility by the transplanted cardiomyocytes. Although our data do not provide direct evidence for such a mechanism, it is supported by a number of findings: 1) the structural and functional cardiomyocyte phenotype of the grafted cells; 2) their ability to functionally integrate with host cardiac tissue as previously demonstrated both in vitro and in vivo (16,17); and 3) the lack of significant improvement after grafting of noncardiomyocyte hESC derivatives.

Despite these encouraging results and the enormous potential of the hESC-CMs, several obstacles need to be overcome before this strategy can become a clinical reality (19). These include the need to generate a directed and more efficient differentiating system, the need to establish selection protocols to derive pure population of cardiac cells (22,23), and the need to scale up the entire process to derive clinically relevant number of cells. In addition, to achieve maximal contractile benefit by the grafted cells, the relatively "immature" hESC-CMs should undergo structural and functional maturation towards an adult-like ventricular phenotype. This issue is also important to reduce the risk for arrhythmias. A beginning of such structural and functional maturation process was already noted in vitro, during prolonged hESC-CM culturing (12,24), and when cultured as 3-dimensional engineered tissue constructs (25). Similarly, the long-term engraftment studies, presented here, also demonstrated some structural maturation of the grafted cells. Finally, strategies to counter immune rejection would probably be required (26). These strategies may include establishing "banks" of major histocompatibility complex antigen-typed hESCs, genetically modifying the hESCs to suppress the expected immune response, induction of tolerance, and somatic nuclear transfer.


    Footnotes
 
This study was partially funded by the Israel Science Foundation (grant no. 1078/04), by the American Cell Therapy Research Foundation, and by the Grand Family research grant.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
1. Laflamme MA, Murray CE. Regenerating the heart Nat Biotechnol 2005;23:845-856.[CrossRef][Web of Science][Medline]

2. Dimmeler S, Zeiher AM, Schneider, MD. Unchain my heart: the scientific foundations of cardiac repair J Clin Invest 2005;115:572-583.[CrossRef][Web of Science][Medline]

3. Menard C, Hagege AA, Agbulut O, et al. Transplantation of cardiac-committed mouse embryonic stem cells to infarcted sheep myocardium: a preclinical study Lancet 2005;366:1005-1012.[CrossRef][Web of Science][Medline]

4. Li RK, Mickle DA, Weisel RD, et al. Natural history of fetal rat cardiomyocytes transplanted into adult rat myocardial scar tissue Circulation 1997;96:II179-II186discussion 186–7.

5. Etzion S, Battler A, Barbash IM, et al. Influence of embryonic cardiomyocyte transplantation on the progression of heart failure in a rat model of extensive myocardial infarction J Mol Cell Cardiol 2001;33:1321-1330.[CrossRef][Web of Science][Medline]

6. Muller-Ehmsen J, Peterson KL, Kedes L, et al. Rebuilding a damaged heart: long-term survival of transplanted neonatal rat cardiomyocytes after myocardial infarction and effect on cardiac function Circulation 2002;105:1720-1726.[Abstract/Free Full Text]

7. Thomson JA, Itskovitz-Eldor J, Shapiro SS, et al. Embryonic stem cell lines derived from human blastocysts Science 1998;282:1145-1147.[Abstract/Free Full Text]

8. Kehat I, Kenyagin-Karsenti D, Snir M, et al. Human embryonic stem cells can differentiate into myocytes with structural and functional properties of cardiomyocytes J Clin Invest 2001;108:407-414.[CrossRef][Web of Science][Medline]

9. Mummery C, Ward-van Oostwaard D, Doevendans P, et al. Differentiation of human embryonic stem cells to cardiomyocytes: role of coculture with visceral endoderm-like cells Circulation 2003;107:2733-2740.[Abstract/Free Full Text]

10. Xu C, Police S, Rao N, Carpenter MK. Characterization and enrichment of cardiomyocytes derived from human embryonic stem cells Circ Res 2002;91:501-508.[Abstract/Free Full Text]

11. He JQ, Ma Y, Lee Y, Thomson JA, Kamp TJ. Human embryonic stem cells develop into multiple types of cardiac myocytes: action potential characterization Circ Res 2003;93:32-39.[Abstract/Free Full Text]

12. Snir M, Kehat I, Gepstein A, et al. Assessment of the ultrastructural and proliferative properties of human embryonic stem cell-derived cardiomyocytes Am J Physiol Heart Circ Physiol 2003;285:H2355-H2363.[Abstract/Free Full Text]

13. Satin J, Kehat I, Caspi O, et al. Mechanism of spontaneous excitability in human embryonic stem cell derived cardiomyocytes J Physiol 2004;559:479-496.[Abstract/Free Full Text]

14. Kehat I, Gepstein A, Spira A, Itskovitz-Eldor J, Gepstein L. High-resolution electrophysiological assessment of human embryonic stem cell-derived cardiomyocytes: a novel in vitro model for the study of conduction Circ Res 2002;91:659-661.[Abstract/Free Full Text]

15. Laflamme MA, Gold J, Xu C, et al. Formation of human myocardium in the rat heart from human embryonic stem cells Am J Pathol 2005;167:663-671.[Abstract/Free Full Text]

16. Kehat I, Khimovich L, Caspi O, et al. Electromechanical integration of cardiomyocytes derived from human embryonic stem cells Nat Biotechnol 2004;22:1282-1289.[CrossRef][Web of Science][Medline]

17. Xue T, Cho HC, Akar FG, et al. Functional integration of electrically active cardiac derivatives from genetically engineered human embryonic stem cells with quiescent recipient ventricular cardiomyocytes: insights into the development of cell-based pacemakers Circulation 2005;111:11-20.[Abstract/Free Full Text]

18. Itskovitz-Eldor J, Schuldiner M, Karsenti D, et al. Differentiation of human embryonic stem cells into embryoid bodies compromising the three embryonic germ layers Mol Med 2000;6:88-95.[Web of Science][Medline]

19. Gepstein L. Derivation and potential applications of human embryonic stem cells Circ Res 2002;91:866-876.[Abstract/Free Full Text]

20. Nascone N, Mercola M. An inductive role for the endoderm in Xenopus cardiogenesis Development 1995;121:515-523.[Abstract]

21. Nussbaum J, Minami E, Laflamme MA, et al. Transplantation of undifferentiated murine embryonic stem cells in the heart: teratoma formation and immune response FASEB J 2007;21:1345-1357.[Abstract/Free Full Text]

22. Huber I, Itzhaki I, Caspi O, et al. Identification and selection of cardiomyocytes during human embryonic stem cell differentiation FASEB J 2007;21:2551-2563.[Abstract/Free Full Text]

23. Klug MG, Soonpaa MH, Koh GY, Field LJ. Genetically selected cardiomyocytes from differentiating embronic stem cells form stable intracardiac grafts J Clin Invest 1996;98:216-224.[Web of Science][Medline]

24. Sartiani L, Bettiol E, Stillitano F, Mugelli A, Cerbai E, Jaconi ME. Developmental changes in cardiomyocytes differentiated from human embryonic stem cells: a molecular and electrophysiological approach Stem Cells 2007;25:1136-1144.[CrossRef][Web of Science][Medline]

25. Caspi O, Lesman A, Basevitch Y, et al. Tissue engineering of vascularized cardiac muscle from human embryonic stem cells Circ Res 2007;100:263-272.[Abstract/Free Full Text]

26. Bradley JA, Bolton EM, Pedersen RA. Stem cell medicine encounters the immune system Nat Rev Immunol 2002;2:859-871.[CrossRef][Web of Science][Medline]


Related Article

Human Stem Cells for Heart Failure Treatment: Ready for Prime Time?
Gianluigi Condorelli and Daniele Catalucci
J. Am. Coll. Cardiol. 2007 50: 1894-1895. [Full Text] [PDF]



This article has been cited by other articles:


Home page
Ann. Thorac. Surg.Home page
J. L. Herrmann, A. M. Abarbanell, B. R. Weil, Y. Wang, M. Wang, J. Tan, and D. R. Meldrum
Cell-based therapy for ischemic heart disease: a clinical update.
Ann. Thorac. Surg., November 1, 2009; 88(5): 1714 - 1722.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. R. Van Orman, D. Weihrauch, D. C. Warltier, and J. Lough
Myocardial interstitial fluid inhibits proliferation and cardiomyocyte differentiation in pluripotent embryonic stem cells
Am J Physiol Heart Circ Physiol, October 1, 2009; 297(4): H1369 - H1376.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. R. Stevens, K. L. Kreutziger, S. K. Dupras, F. S. Korte, M. Regnier, V. Muskheli, M. B. Nourse, K. Bendixen, H. Reinecke, and C. E. Murry
Physiological function and transplantation of scaffold-free and vascularized human cardiac muscle tissue
PNAS, September 29, 2009; 106(39): 16568 - 16573.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
J. Leor, S. Tuvia, V. Guetta, F. Manczur, D. Castel, U. Willenz, O. Petnehazy, N. Landa, M. S. Feinberg, E. Konen, et al.
Intracoronary injection of in situ forming alginate hydrogel reverses left ventricular remodeling after myocardial infarction in Swine.
J. Am. Coll. Cardiol., September 8, 2009; 54(11): 1014 - 1023.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. Liu, D. K. Lieu, C. W. Siu, J.-D. Fu, H.-F. Tse, and R. A. Li
Facilitated maturation of Ca2+ handling properties of human embryonic stem cell-derived cardiomyocytes by calsequestrin expression
Am J Physiol Cell Physiol, July 1, 2009; 297(1): C152 - C159.
[Abstract] [Full Text] [PDF]


Home page
Vasc MedHome page
D. P Sieveking and M. K. Ng
Cell therapies for therapeutic angiogenesis: back to the bench
Vascular Medicine, May 1, 2009; 14(2): 153 - 166.
[Abstract] [PDF]


Home page
Circ. Res.Home page
H. Reinecke, E. Minami, W.-Z. Zhu, and M. A. Laflamme
Cardiogenic Differentiation and Transdifferentiation of Progenitor Cells
Circ. Res., November 7, 2008; 103(10): 1058 - 1071.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R.-J. Swijnenburg, S. Schrepfer, J. A. Govaert, F. Cao, K. Ransohoff, A. Y. Sheikh, M. Haddad, A. J. Connolly, M. M. Davis, R. C. Robbins, et al.
Immunosuppressive therapy mitigates immunological rejection of human embryonic stem cell xenografts
PNAS, September 2, 2008; 105(35): 12991 - 12996.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
N. L. Tulloch, L. Pabon, and C. E. Murry
Get With the (Re)Program: Cardiovascular Potential of Skin-Derived Induced Pluripotent Stem Cells
Circulation, July 29, 2008; 118(5): 472 - 475.
[Full Text] [PDF]


Home page
J Am Coll CardiolHome page
A. N. DeMaria, J. J. Bax, O. Ben-Yehuda, P. Clopton, G. K. Feld, G. S. Ginsburg, B. H. Greenberg, J. D. Knoke, W. Y.W. Lew, J. A.C. Lima, et al.
Highlights of the year in JACC 2007.
J. Am. Coll. Cardiol., January 29, 2008; 51(4): 490 - 512.
[Full Text] [PDF]


Home page
J Am Coll CardiolHome page
G. Condorelli and D. Catalucci
Human Stem Cells for Heart Failure Treatment: Ready for Prime Time?
J. Am. Coll. Cardiol., November 6, 2007; 50(19): 1894 - 1895.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
j.jacc.2007.07.054v1
50/19/1884    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (37)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Caspi, O.
Right arrow Articles by Gepstein, L.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Caspi, O.
Right arrow Articles by Gepstein, L.
Related Collections
Right arrowRelated Article

 
  CME Topic Collections Past Issues Search Current Issue Home

Advertisement