Advertisement

Click here for more guidelines.

 
 




CME Topic Collections Past Issues Search Current Issue Home
     

J Am Coll Cardiol, 2007; 49:2430-2439, doi:10.1016/j.jacc.2007.02.063 (Published online 11 June 2007).
© 2007 by the American College of Cardiology Foundation
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
j.jacc.2007.02.063v1
49/25/2430    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Tintelen, J. P.
Right arrow Articles by Pinto, Y. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Tintelen, J. P.
Right arrow Articles by Pinto, Y. M.
Related Collections
Right arrowRelated Article

CLINICAL RESEARCH: CARDIOMYOPATHY

Severe Myocardial Fibrosis Caused by a Deletion of the 5’ End of the Lamin A/C Gene

J. Peter van Tintelen, MD*,*, Rene A. Tio, MD, PhD{dagger}, Wilhelmina S. Kerstjens-Frederikse, MD*, Jop H. van Berlo, MD{ddagger}, Ludolf G. Boven, BSc*, Albert J.H. Suurmeijer, MD, PhD§, Stefan J. White, PhD||, Johan T. den Dunnen, PhD||, Gerard J. te Meerman, PhD*, Yvonne J. Vos, MSc*, Annemarie H. van der Hout, PhD*, Jan Osinga*, Maarten P. van den Berg, MD, PhD{dagger}, Dirk J. van Veldhuisen, MD, PhD{dagger}, Charles H.C.M. Buys, PhD*, Robert M.W. Hofstra, PhD* and Yigal M. Pinto, MD, PhD{ddagger}

* Department of Genetics, University Medical Center Groningen, University of Groningen, Groningen, the Netherlands
{dagger} Department of Cardiology, University Medical Center Groningen, University of Groningen, Groningen, the Netherlands
§ Department of Pathology, University Medical Center Groningen, University of Groningen, Groningen, the Netherlands
{ddagger} Department of Cardiology, University Hospital Maastricht, Maastricht, the Netherlands
|| Department of Human and Clinical Genetics, Leiden University Medical Center, Leiden, the Netherlands.

Manuscript received April 25, 2006; revised manuscript received February 9, 2007, accepted February 12, 2007.

* Reprint requests and correspondence: Dr. J. Peter van Tintelen, Department of Genetics, University Medical Center Groningen, P.O. Box 30001, 9700 RB Groningen, the Netherlands. (Email: p.van.tintelen{at}medgen.umcg.nl).


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Objectives: The goal of this study was to identify the underlying gene defect in a family with inherited myocardial fibrosis.

Background: A large family with an autosomal dominantly inherited form of myocardial fibrosis with a highly malignant clinical outcome has been investigated. Because myocardial fibrosis preceded the clinical and echocardiographic signs, we consider the disease to be a hereditary form of cardiac fibrosis.

Methods: Twenty-five family members were clinically evaluated, and 5 unaffected and 8 affected family members were included in a genome-wide linkage study.

Results: The highest logarithm of the odds (LOD) score (LOD = 2.6) was found in the region of the lamin AC (LMNA) gene. The LMNA mutation analysis, both by denaturing gradient gel electrophoresis and sequencing, failed to show a mutation. Subsequent Southern blotting, complementary deoxyribonucleic acid sequencing, and multiplex ligation-dependent probe amplification analysis, however, revealed a deletion of the start codon-containing exon and an adjacent noncoding exon. In vitro studies demonstrated that the deletion results in the formation of nuclear aggregates of lamin, suggesting that the mutant allele is being transcribed.

Conclusions: This novel LMNA deletion causes a distinct, highly malignant cardiomyopathy with early-onset primary cardiac fibrosis likely due to an effect of the shortened mutant protein, which secondarily leads to arrhythmias and end-stage cardiac failure.

Abbreviations and Acronyms
  DCM = dilated cardiomyopathy
  DGGE = denaturing gradient gel electrophoresis
  DNA = deoxyribonucleic acid
  EMB = endomyocardial biopsy
  IDCM = idiopathic dilated cardiomyopathy
  LMNA = lamin AC
  MLPA = multiplex ligation-dependent probe amplification
  PCR = polymerase chain reaction
  RNA = ribonucleic acid


Dilated cardiomyopathy (DCM) is characterized by dilatation and impaired contractile function of the left ventricle. The mortality rate is high, with the 5-year survival rate around 50% (1). The incidence is about 4 of 10,000/year, making it one of the most important reasons for cardiac transplantation (2). Up to 50% of cases lack an underlying diagnosis, which justifies its classification as "idiopathic" dilated cardiomyopathy (IDCM) (3).

The familial character of IDCM has become increasingly clear in that several recent studies have shown that up to 35% of all IDCM patients have at least 1 affected (first-degree) relative (4–7). In at least 60% of these familial IDCM cases, an autosomal-dominant inheritance pattern is suggested (6–8).

Among the most frequently reported genetic causes of DCM, identified in up to 30% of cases of DCM in association with cardiac conduction disease or supraventricular arrhythmias, are mutations in the gene encoding lamin A and C (LMNA) proteins (9,10).

Dilated cardiomyopathy is clinically highly variable, encompassing the spectrum from frank dilatation with relatively little fibrosis to less dilative forms with more severe derangement of myocardial histology. Myocardial fibrosis accompanies virtually all forms of cardiomyopathy, including inherited forms, and is therefore commonly regarded to be a secondary phenomenon. The idea that fibrosis is secondary to heart failure has been fueled by the fact that genetic defects that give rise to extensive primary myocardial fibrosis have not as yet been described.

In presenting here a large family with a hereditary form of early onset cardiac fibrosis, we will be addressing the question of whether primary myocardial fibrosis can be considered as a separate disease entity or should be regarded as a subphenotype of DCM.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Investigated family and cardiological investigations.   The investigated family has been known at our hospital for nearly 50 years (11). As part of our clinical genetic-counseling procedure, we asked patients to inform relatives about the possibility of genetic counseling and cardiological evaluation. Patients who were investigated gave their written informed consent. To establish the clinical phenotype, electrocardiographic recording, exercise testing, echocardiography, signal-averaged electrocardiography, and 24-h electrocardiography were performed. Owing to the extensive and early fibrosis that has been described this family (11), all family members suspected of being affected (as indicated by atrioventricular blockade or supraventricular arrhythmias on 24-h Holter monitoring) underwent a right-ventricular endomyocardial biopsy (EMB) after obtaining a fully normal coronary angiogram that included a left ventricular angiogram.

Histology.   Paraffin sections of EMB and postmortem full-thickness sections of right and left ventricular myocardium were stained with hematoxylin and eosin. A Masson trichrome stain was used to determine the amount of collagen. Patients with manifest (interstitial) fibrosis were considered as being affected.

Deoxyribonucleic acid isolation.   Blood samples were collected from all marked-affected and unaffected subjects of the family involved (Fig. 1). Genomic deoxyribonucleic acid (DNA) was extracted from peripheral blood leukocytes with the salting-out procedure (12).


Figure 1
View larger version (5K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1 Pedigree of the Family

Solid symbols indicate clinically and genetically affected persons (deletion carriers). One-quarter black-filled symbols indicate those clinically affected upon personal examination or from medical records or literature (11). Open symbols indicate clinically unaffected individuals and line-through symbols indicate deceased individuals. Squares represent men, and circles represent women. *The respective person has been evaluated genetically. The haplotypes are represented in Table 2. SCD = sudden cardiac death.

 
Linkage analysis.   Genome-wide mapping was performed with approximately 300 fluorescent microsatellite markers (ISOGEN Bioscience, Maarsen, the Netherlands), spread over the entire genome with an average resolution of 10 cM. DeCODE, Marshfield, and Genethon human-linkage maps were used as guidance for intermarker distances.

Standard polymerase chain-reaction (PCR) amplification was performed in 20 µl containing 150 ng of genomic DNA and 10 pmol of fluorescently labeled primers. Reaction products from 4 to 8 markers were pooled and separated on an automatic ABI 377 DNA sequencer or on a MegaBACE 1000. Marker analysis was performed with the GENESCAN v3.1 and GENOTYPER v2.5 software (Applied Biosystems, Foster City, California), respectively. Linkage analysis was performed with Gronlod (13) with a 5% recombination frequency, a penetrance of 90%, and a phenocopy rate of 10%.

Denaturing gradient-gel electrophoresis and sequence analysis of the LMNA gene.   Point-mutation analysis for the LMNA gene was performed with both denaturing gradient-gel electrophoresis (DGGE) and sequencing. Thirteen amplicons were analyzed with both methods (J. P. van Tintelen, unpublished data, 2005; primers available upon request).

For sequencing, PCR products were purified with the High Pure PCR Product Purification Kit (Boehringer Mannheim, Mannheim, Germany) and then sequenced with the Thermo Sequenase Kit (Amersham Life Science, Buckinghamshire, United Kingdom) or the Sequenase kit (USB, Cleveland, Ohio).

Southern blots.   Genomic DNA (8 µg) was digested either with BamHI and XbaI or with Bgl2 and EcoRV. The DNA fragments were separated overnight by gel electrophoresis in a 0.7% agarose gel and were transferred under denaturing conditions (0.4 mol/l sodium hydroxide and 0.6 mol/l sodium chloride) to a Hybond N+ membrane. The filters were rinsed, air-dried, and baked at 80°C for 2 h. Prehybridization was carried out in a 0.5 mol/l phosphate buffer, 6% sodium dodecyl sulfate (SDS), 1.0 mmol/l ethylenediaminetetraacetic acid (EDTA) solution for 30 min at 65°C and hybridization in fresh solution overnight with [32P]dCTP-labeled LMNA complementary DNA (cDNA) probe (a 2027 base pair [bp] insert of an LMNA cDNA [IMAGp958B1610Q2]). Filters were washed twice in 2 x standard saline citrate (SSC), 0.1% SDS at 65°C for 15 min, and in 1 x SSC, 0.1% SDS for 15 min, and in 0.3 x SSC, 0.1% SDS for 10 min at 65°C. After washing the blot was exposed to X-ray Kodak XAR film with intensifying screens at –80°C for several days.

cDNA analysis.   Ribonucleic acid (RNA; 2.5 µg), isolated from deletion carrier III-12, was used to make cDNA with the Ready-To-Go You-Prime-First-Strand Beads Kit (Amersham Biosciences) according to the manufacturer’s protocol. This cDNA was used to perform PCR with the exon –2 forward primer (CGGAGATCTCAGAGGCACCGAC) and an exon +3 reverse primer (GCAGCATCTCATCCTGAAGT). The PCR products were purified and sequenced as described previously.

Multiplex ligation-dependent probe amplification.   For the detection of large deletions or duplications of whole exons, we also used the multiplex ligation-dependent probe amplification (MLPA) test (MRC-Holland, Amsterdam, the Netherlands) (14,15). The probe mix contains 8 coding exon probes for the LMNA gene (exons 1, 2, 3, 4, 6, 7, 8, and 10). In addition, we designed a set containing 3 adjacent non-coding exon probes (numbered –1, –2 and –3, respectively, where exon –1 is adjacent to the LMNA gene) at the 5’ region of the LMNA gene and 4 control probes specific for DNA sequences outside the LMNA gene.

Cell culture, immunoblotting, and indirect immunofluorescence.   Human dermal fibroblasts from a patient and an unaffected relative were cultured at 37°C under 5% carbon dioxide in Dulbecco’s Modified Eagle’s Medium, supplemented with 10% fetal bovine serum.

Cells were counted and plated in 6-well plates, allowed to attach for 24 h, and lysed with the sample buffer. Protein samples were sheared through a 23G needle and boiled at 95°C for 10 min. Proteins were separated in 8% acrylamid gels and transferred onto polyvinylidene fluoride (PDVF) membranes. Primary antibodies against lamins A and C (Jol2, gift from Dr. C. J. Hutchison, Durham, United Kingdom) and GAPDH (RDI TRK5G4-6C5) were incubated overnight at 4°C in 3.5% Protifar plus (Nutricia, Zoetermeer, the Netherlands) in TRIS-buffered saline, 0.1% Tween. The secondary antibody, rabbit anti-mouse IgG HRP-linked, was visualized with enhanced chemoluminescence.

For immunofluorescence studies, cells were plated on coverslips, allowed to attach for 24 h, and fixed in 3.7% formaldehyde. Cells were permeabilized with 0.1% Triton and stained with primary antibody against lamin A (133a2) and counterstained with FITC-conjugated rabbit anti-mouse IgG (F0232, DAKO, Heverlee, Belgium). Immunofluorescence-labeled cells were counterstained with the DNA dye 4’-6-diamidino-2-phenylindole (DAPI). Nuclear aggregates of 100 separate nuclei were counted.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Clinical and histopathological evaluation.   We evaluated 29 individuals from 3 generations (Fig. 1); generation II has been described previously (11). Twenty-five family members visited us for screening starting in 1995 (11 men, 14 women). We studied the clinical records and postmortem examinations of 4 additional persons (3 women) who had died (III-3, -7, -8, and -11) (Fig. 1). No signs of neuromuscular disease or lipodystrophy were noted. Creatine phosphokinase (CPK) values were within normal limits. Two patients (III-17 and -18) died during follow-up.

Of the 29 family members we studied, 18 were suspected to be affected either on clinical grounds or because of premature death (Fig. 1). Of these 18 subjects, 15 were histologically investigated: 13 underwent EMB (4 of these with additional postmortem or post-transplantation examinations). In 2 patients only postmortem investigations were available. Myocardial fibrosis was found in 14 of these 15 histologically investigated subjects. In 4 of these (III-12, III-15, IV-8, IV-9) (Table 1), distinct pathological fibrosis was identified as compared with the more extensive fibrosis in the remaining 10 patients. In patient IV-6, EMB showed fibrolipomatosis that could not be distinguished from arrhythmogenic right ventricular cardiomyopathy. Histological postmortem examinations of full-thickness myocardium in 5 patients (III-3, -7, -11, -17, and -18) all demonstrated extensive areas of interstitial and replacement fibrosis throughout the left and right ventricular myocardium and extensive fibrosis of the cardiac conduction system. The definite diagnosis was decided on the basis of a positive biopsy or postmortem histological proof of fibrosis.


View this table:
[in this window]
[in a new window]

 
Table 1 Clinical Characteristics of Mutation Carriers and Individual IV-6
 
More importantly, fibrosis (III-15, IV-2, -5, -8, and -9) or fibrolipomatosis (IV-6) was detected in 6 subjects who did not exhibit any abnormalities on echocardiography; in 4 of them (III-15, IV-2, IV-5, and IV-6) palpitations were the only complaint. In asymptomatic subjects, a first-degree atrioventricular block or supraventricular tachycardias raised the suspicion that they might be affected, which resulted in the treating physician ordering an EMB, which revealed fibrosis.

Thus, of all 14 of the affected family members with pathological interstitial myocardial fibrosis, 5 had cardiac fibrosis and 1 had fibrolipomatosis without any important loss of left ventricular function. The clinical data and survival curve for these patients are shown in Table 1 and Figure 2.


Figure 2
View larger version (8K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2 Kaplan-Meier Survival Curve

Kaplan-Meier curve with end points cardiac death or cardiac transplantation.

 
Genetic analysis.   Genome-wide linkage screening yielded the highest logarithm of the odds (LOD) score (LOD score = 2.6) for the region containing the LMNA gene. The haplotypes around this gene and individuals studied are shown in Table 2. Besides this region, no other regions showed a LOD score over 1.5. Although linkage was not completely conclusive, the gene was screened for point mutations with DGGE and direct-sequence analysis. These analyses did not reveal any sequence variation. Subsequent Southern blot analysis with 2 different double digests showed a deletion of the exon containing the start codon of the LMNA gene (Fig. 3). The PCR on cDNA revealed 2 PCR products of approximately 900 and 250 bp in length (Fig. 4). Subsequent sequence analysis showed that the longest cDNA fragment contained all exons, whereas the shorter band was lacking exons –1 and +1 of the LMNA gene (Fig. 5). This resulted in a deletion of 674 bp, which explains the 2 different-sized bands on the agarose gel. Subsequent MLPA analysis confirmed the deletion of exon 1 (Table 3), whereas the other coding exons had been retained. Because of technical difficulties in the design of the primers, a deletion of exon –1 could not be confirmed with this technique.


View this table:
[in this window]
[in a new window]

 
Table 2 Haplotypes Around the LMNA Gene
 

Figure 3
View larger version (89K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3 Southern Blot Analysis of LMNA Deletion Carriers and Control Subjects

Southern blot showing reduced intensities of the signal corresponding with the start codon–containing exon of the lamin AC (LMNA) gene in affected patients (IV-8, IV-9, IV-11) as compared with control subjects (C) and a nonaffected family member (IV-10).

 

Figure 4
View larger version (79K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4 PCR on Complementary Deoxyribonucleic Acid

Reverse transcription polymerase chain reaction (RT-PCR) on ribonucleic acid (RNA) extracted from fibroblasts of patient III-12 and from lymphocytes of a control individual. The RNA of the patient show, in addition to the normal-sized band, a shorter product that after sequencing proved to have lost both exons –1 and +1. The normal-sized product is weaker, owing to the fact that shorter amplicons are more abundantly amplified.

 

Figure 5
View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5 Sequence Analysis of cDNA in Deletion Carrier and Control Subjects

Forward complementary deoxyribonucleic acid (cDNA) sequence and schematic representation of the 5’ region of the lamin AC gene on cDNA level in the wild type (A) and mutated situation (B; patient III-12). mRNA = messenger ribonucleic acid.

 

View this table:
[in this window]
[in a new window]

 
Table 3 Multiplex Ligation-Dependent Probe Amplification Normalized Peak Area Ratios of the LMNA Gene
 
Deoxyribonucleic acid samples were available for 16 of the 18 clinically affected family members. The LMNA deletion was identified in all but 1 (IV-6) of these 16 persons.

Screening IDCM patients for LMNA deletion.   Investigations in 150 additional patients with familial and non-familial DCM (with or without cardiac conduction disease and/or supraventricular arrhythmias) and in a control group of 150 unaffected persons have not revealed any further intragenic LMNA deletions.

Cell culture studies.   To assess the effect of this novel deletion on the expression of lamins, we performed Western blot and indirect immunofluorescence assays. Western blot analysis of lamins A and C clearly showed decreased expression of both normal-sized lamins A and C in cells from a mutation carrier, when compared with the expression of the control cells (Fig. 6). Indirect immunofluorescence clearly showed an increased number of nuclear aggregates in cells from a lamin mutation carrier but hardly any aggregates in control cells (Fig. 7) (0.54 [SEM 0.10] in control cells vs. 6.05 [SEM 0.32] in cells from an LMNA mutation carrier [p < 0.0001]).


Figure 6
View larger version (81K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6 Western Blot Analysis of Lamins A and C in Fibroblasts

Western blot analysis showing decreased expression of both lamins A and C in fibroblasts from mutation carrier (B), as compared with a non-carrier family member (A). No alternative product from the mutated allele was seen. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serves as a control that equal amounts of protein have been loaded.

 

Figure 7
View larger version (87K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 7 Indirect Immunofluorescence Assay With Lamin A Antibody

Indirect immunofluorescence with lamin A antibody showing nuclear lamin aggregates in fibroblasts from mutation carrier but not in control fibroblasts. DAPI = 4’-6-diamidino-2-phenylindole.

 

    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
In a family with early onset myocardial fibrosis, we identified a deletion of the 5’ end of the LMNA gene including the start codon containing exon, located in the region of the highest LOD score. The LOD score at this locus did not exceed 2.6, because individual IV-6, referred for palpitations and initially classified as clinically affected, neither showed linkage to this region nor had the deletion. Her EMB showed fibrolipomatosis that could not be distinguished from arrhythmogenic right ventricular cardiomyopathy. We therefore consider the clinical picture of IV-6 a phenocopy unrelated to the inherited disorder in other family members.

Southern blot analysis indicated a deletion that was subsequently confirmed by PCR on cDNA and MLPA. Western blot analysis did show decreased expression of both lamins A and C in fibroblasts from a mutation carrier as compared with a non-carrier, although no alternative product from the mutated allele was seen (Fig. 6). An explanation for this might be that the truncated protein is less stable.

It is striking that fibrosis was massive and so easily encountered at biopsy. In 6 patients cardiac fibrosis was present before cardiac function was clearly affected as judged by echocardiography. Although it cannot be excluded that fibrosis is secondary to loss of a small number of myocytes as reactive fibrosis, this severe fibrosis occurs early in the disease and seems less likely to be secondary to overt failure. Severe myocardial fibrosis was also noted in the majority of the first families described by Fatkin et al. (9) as having DCM due to LMNA gene mutations, and also fibrosis of skeletal muscles has been noted before (16,17). The early occurrence of severe cardiac fibrosis in the absence of cardiac-function loss in the presented family practically excludes that cardiac fibrosis is caused by overt, severe heart failure but is initiated very early in the course of the disease. Our finding of nuclear aggregates of lamin in cultured fibroblasts from a mutation carrier substantiates the effect of this deletion. This raises the possibility that other LMNA gene mutations might also cause primary fibrosis, thus forming the underlying pathology in this cardiac phenotype.

Pathophysiologic effect of the LMNA deletion containing the start codon.   The LMNA gene encodes lamins A and C by means of alternative splicing. These proteins are major components of the nuclear lamina, a fibrous network underlying the inner surface of the nuclear envelope (18). Mutations in the lamin A/C gene have been reported in a variety of disorders, such as autosomal dominant and recessive Emery-Dreifuss muscular dystrophy (19,20); limb-girdle muscular dystrophy type 1B (21); autosomal recessive Charcot-Marie-Tooth disease type 2B1 (22); Dunnigan-type familial partial lipodystrophy (23–25); mandibuloacral dysplasia (26); the Hutchinson-Gilford progeria syndrome (27,28); atypical Werner’s syndrome (29); and lipoatrophy with diabetes, hepatic steatosis, hypertrophic cardiomyopathy, and leukomelanodermic papules (30). Finally, LMNA gene mutations have been identified in patients having IDCM with conduction disease (11) or "pure" DCM (31,32). The exact pathophysiological mechanism of LMNA mutations that lead to such an impressive heterogeneous spectrum of disorders has not yet been elucidated. However, myocardial fibrosis as a secondary phenomenon has been described before in different laminopathies (10,15,33).

The identified deletion of the 5’ end of the LMNA gene containing the start codon is predicted to affect mainly the head domain of lamin (that is, it might lead to a shortened protein lacking the head domain). Assuming that the deletion does not interfere with the splicing of the other exons, new potential translation initiation sites should lie at cDNA position 559 and 598 (amino acids 187 and 200, respectively). When these proteins are produced, they lack the N-terminal region of lamin A and C, resulting in a smaller protein, which lacks the head domain. Previously, targeted mutation studies in Chinese hamster ovary cells have shown that functional disruption of the head domain has dominant negative effects, because these aberrant proteins can form aggregates of lamin in the nucleus (34). In line with this in vitro observation, we also found an increased number of lamin nuclear aggregates in cultured fibroblasts of a carrier of this deletion, as opposed to the virtual absence of these aggregates in a non-deletion carrier family member. This suggests that the mechanisms identified in vitro (34) do cause cardiac pathology in vivo possibly via a dominant negative effect. This raises the possibility that other LMNA gene mutations might also cause primary fibrosis, thus forming the underlying pathology of this cardiac phenotype.

Do lamin A/C mutations cause a specific cardiac phenotype?.   The large pedigree made it possible to clinically evaluate patients at the earliest sign of being affected (that is, when demonstrating subtle cardiac (supraventricular) arrhythmias or cardiac conduction disease). The LMNA mutations can give rise to cardiac conduction disease (10). The histopathological substrate for the occurrence of conduction disease, however, remains unclear. We were, however, able to demonstrate that pathological myocardial fibrosis occurs at the first signs of conduction delay in a relatively large number of the family members affected. At postmortem examinations, extensive fibrosis of the conduction system was especially notable, because in 6 of the patients cardiac fibrosis was present before cardiac function was clearly affected as judged by echocardiography.

Another distinct finding was the small extent of dilatation for a mutant gene often described as a cause of DCM. Despite severe cardiac complications in laminopathies, this observation has been made before (35–39). Therefore these combined data suggest that LMNA mutations might cause a distinct cardiomyopathy, characterized by fibrosis and rather limited cardiac dilatation, which suggests a distinct disease entity within the spectrum of idiopathic "dilated" cardiomyopathy. This implies that distinct forms of cardiomyopathy can be encountered and that LMNA mutations might give rise to a type of cardiomyopathy in which primary fibrosis drives the specific pathophysiology on a highly malignant course. Myocardial fibrosis, therefore, might not occur as a separate disease entity but rather as a subphenotype of DCM.


    Acknowledgments
 
The authors wish to thank J. M. C. Went for her support in collecting data and Marian Kraak for her assistance in MLPA.


    Footnotes
 
This work was supported by grants to Drs. Pinto and van Berlo (2000.130, 2002T016) from the Netherlands Heart Foundation and is a part of research lines 27 and 50 of the Interuniversity Cardiology Institute of the Netherlands. The first two authors contributed equally to this article.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
1. Michels VV, Driscoll DJ, Miller FA, et al. Progression of familial and non-familial dilated cardiomyopathy: long term follow up Heart 2003;89:757-761.[Abstract/Free Full Text]

2. Hosenpud JD, Bennett LE, Keck BM, Fiol B, Boucek MM, Novick RJ. The Registry of the International Society for Heart and Lung Transplantation: sixteenth official report—1999 J Heart Lung Transplant 1999;18:611-626.[CrossRef][Web of Science][Medline]

3. Felker GM, Hu W, Hare JM, Hruban RH, Baughman KL, Kasper EK. The spectrum of dilated cardiomyopathyThe Johns Hopkins experience with 1,278 patients. Medicine (Baltimore) 1999;78:270-283.[CrossRef][Medline]

4. Grunig E, Tasman JA, Kucherer H, Franz W, Kubler W, Katus HA. Frequency and phenotypes of familial dilated cardiomyopathy J Am Coll Cardiol 1998;31:186-194.[Abstract/Free Full Text]

5. Crispell KA, Wray A, Ni H, Nauman DJ, Hershberger RE. Clinical profiles of four large pedigrees with familial dilated cardiomyopathy: preliminary recommendations for clinical practice J Am Coll Cardiol 1999;34:837-847.[Abstract/Free Full Text]

6. Mangin L, Charron P, Tesson F, et al. Familial dilated cardiomyopathy: clinical features in French families Eur J Heart Fail 1999;1:353-361.[CrossRef][Web of Science][Medline]

7. Gavazzi A, Repetto A, Scelsi L, et al. Evidence-based diagnosis of familial non–X-linked dilated cardiomyopathyPrevalence, inheritance and characteristics. Eur Heart J 2001;22:73-81.[Abstract/Free Full Text]

8. Mestroni L, Krajinovic M, Severini GM, et al. Familial dilated cardiomyopathy Br Heart J 1994;72(Suppl 6):S35-S41.

9. Fatkin D, MacRae C, Sasaki T, et al. Missense mutations in the rod domain of the lamin A/C gene as causes of dilated cardiomyopathy and conduction-system disease N Engl J Med 1999;341:1715-1724.[CrossRef][Web of Science][Medline]

10. Arbustini E, Pilotto A, Repetto A, et al. Autosomal dominant dilated cardiomyopathy with atrioventricular block: a lamin A/C defect-related disease J Am Coll Cardiol 2002;39:981-990.[Abstract/Free Full Text]

11. Nieveen J, Huber J. Familial myocardial fibrosis Acta Med Scand 1970;188:439-445.[Web of Science][Medline]

12. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells Nucleic Acids Res 1998;16:1215.[CrossRef]

13. Te Meerman GJ, Mullaart E, van der Meulen MA, et al. Linkage analysis by two-dimensional DNA typing Am J Hum Genet 1993;53:1289-1297.[Medline]

14. Schouten JP, McElgunn CJ, Waaijer R, Zwijnenburg D, Diepvens F, Pals G. Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification Nucleic Acids Res 2002;30:e57.[Abstract/Free Full Text]

15. White SJ, Vink GR, Kriek M, et al. Two-color multiplex ligation-dependent probe amplification: detecting genomic rearrangements in hereditary multiple exostoses Hum Mutat 2004;24:86-92.[CrossRef][Web of Science][Medline]

16. van der Kooi AJ, Ledderhof TM, de Voogt WG, et al. A newly recognized autosomal dominant limb girdle muscular dystrophy with cardiac involvement Ann Neurol 1996;39:636-642.[CrossRef][Medline]

17. Brodsky GL, Muntoni F, Miocic S, Sinagra G, Sewry C, Mestroni L. Lamin A/C gene mutation associated with dilated cardiomyopathy with variable skeletal muscle involvement Circulation 2000;101:473-476.[Abstract/Free Full Text]

18. Lin F, Worman HJ. Structural organization of the human gene encoding nuclear lamin A and nuclear lamin C J Biol Chem 1993;268:16321-16326.[Abstract/Free Full Text]

19. Bonne G, Di Barletta MR, Varnous S, et al. Mutations in the gene encoding lamin A/C cause autosomal dominant Emery-Dreifuss muscular dystrophy Nat Genet 1999;21:285-288.[CrossRef][Web of Science][Medline]

20. Raffaele Di Barletta M, Ricci E, Galluzzi G, et al. Different mutations in the LMNA gene cause autosomal dominant and autosomal recessive Emery-Dreifuss muscular dystrophy Am J Hum Genet 2000;66:1407-1412.[CrossRef][Web of Science][Medline]

21. Muchir A, Bonne G, van der Kooi AJ, et al. Identification of mutations in the gene encoding lamins A/C in autosomal dominant limb girdle muscular dystrophy with atrioventricular conduction disturbances (LGMD1B) Hum Mol Genet 2000;9:1453-1459.[Abstract/Free Full Text]

22. De Sandre-Giovannoli A, Chaouch M, Kozlov S, et al. Homozygous defects in LMNA, encoding lamin A/C nuclear-envelope proteins, cause autosomal recessive axonal neuropathy in human (Charcot-Marie-Tooth disorder type 2) and mouse Am J Hum Genet 2002;70:726-736Erratum in: Am J Hum Genet 2002;70:1075.[CrossRef][Web of Science][Medline]

23. Cao H, Hegele RA. Nuclear lamin A/C R482Q mutation in Canadian kindreds with Dunnigan-type familial partial lipodystrophy Hum Mol Genet 2000;9:109-112.[Abstract/Free Full Text]

24. Shackleton S, Lloyd DJ, Jackson SNJ, et al. LMNA, encoding lamin A/C, is mutated in partial lipodystrophy Nat Genet 2000;24:153-156.[CrossRef][Web of Science][Medline]

25. Speckman RA, Garg A, Du F, et al. Mutational and haplotype analyses of families with familial partial lipodystrophy (Dunnigan variety) reveal recurrent missense mutations in the globular C-terminal domain of lamin A/C Am J Hum Genet 2000;66:1192-1198(erratum in: Am J Hum Genet 2000;67:775).[CrossRef][Web of Science][Medline]

26. Novelli G, Muchir A, Sangiuolo F, et al. Mandibuloacral dysplasia is caused by a mutation in LMNA-encoding lamin A/C Am J Hum Genet 2002;71:426-431.[CrossRef][Web of Science][Medline]

27. Eriksson M, Brown WT, Gordon LB, et al. Recurrent de novo point mutations in lamin A cause Hutchinson-Gilford progeria syndrome Nature 2003;423:293-298.[CrossRef][Medline]

28. De Sandre-Giovannoli A, Bernard R, Cau P, et al. Lamin a truncation in Hutchinson-Gilford progeria Science 2003;300:2055.[Free Full Text]

29. Chen L, Lee L, Kudlow BA, et al. LMNA mutations in atypical Werner’s syndrome Lancet 2003;362:440-445.[CrossRef][Web of Science][Medline]

30. Caux F, Dubosclard E, Lascols O, et al. A new clinical condition linked to a novel mutation in lamins A and C with generalized lipoatrophy, insulin-resistant diabetes, disseminated leukomelanodermic papules, liver steatosis, and cardiomyopathy J Clin Endocrinol Metab 2003;88:1006-1013.[Abstract/Free Full Text]

31. Genschel J, Schmidt HH. Mutations in the LMNA gene encoding lamin A/C Hum Mutat 2000;16:451-459.[CrossRef][Web of Science][Medline]

32. Genschel J, Bochow B, Kuepferling S, et al. A R644C mutation within lamin A extends the mutations causing dilated cardiomyopathy Hum Mutat 2001;17:154.[Medline]

33. Charniot JC, Pascal C, Bouchier C, et al. Functional consequences of an LMNA mutation associated with a new cardiac and non-cardiac phenotype Hum Mutat 2003;21:473-481.[CrossRef][Web of Science][Medline]

34. Izumi M, Vaughan OA, Hutchison CJ, Gilbert DM. Head and/or CaaX domain deletions of lamin proteins disrupt preformed lamin A and C but not lamin B structure in mammalian cells Mol Biol Cell 2000;11:4323-4337.[Abstract/Free Full Text]

35. van Berlo JH, de Voogt WG, van der Kooi AJ, et al. Clinical characteristics of 299 carriers of LMNA gene mutations: do lamin A/C mutations portend a high risk of sudden death? J Mol Med 2005;83:79-83.[CrossRef][Web of Science][Medline]

36. Sanna T, Dello Russo A, Toniolo D, et al. Cardiac features of Emery-Dreifuss muscular dystrophy caused by lamin A/C gene mutations Eur Heart J 2003;24:2227-2236.[Abstract/Free Full Text]

37. Jakobs PM, Hanson EL, Crispell KA, et al. Novel lamin A/C mutations in two families with dilated cardiomyopathy and conduction system disease J Card Fail 2001;7:249-256.[CrossRef][Web of Science][Medline]

38. Ki CS, Hong JS, Jeong GY, et al. Identification of lamin A/C (LMNA) gene mutations in Korean patients with autosomal dominant Emery-Dreifuss muscular dystrophy and limb-girdle muscular dystrophy 1B J Hum Genet 2002;47:225-228.[CrossRef][Web of Science][Medline]

39. Karkkainen S, Helio T, Miettinen R, et al. A novel mutation, Ser143Pro, in the lamin A/C gene is common in Finnish patients with familial dilated cardiomyopathy Eur Heart J 2004;25:885-893.[Abstract/Free Full Text]


Related Article

Inside this Issue of JACC
J. Am. Coll. Cardiol. 2007 49: A31-A32. [Full Text] [PDF]



This article has been cited by other articles:


Home page
Circ Cardiovasc GenetHome page
R. F. Marsman, A. Bardai, A. V. Postma, J. C. J. Res, T. T. Koopmann, L. Beekman, A. C. van der Wal, Y. M. Pinto, R. H. Lekanne Deprez, A. A. M. Wilde, et al.
A Complex Double Deletion in LMNA Underlies Progressive Cardiac Conduction Disease, Atrial Arrhythmias, and Sudden Death
Circ Cardiovasc Genet, June 1, 2011; 4(3): 280 - 287.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
W. Wu, A. Muchir, J. Shan, G. Bonne, and H. J. Worman
Mitogen-Activated Protein Kinase Inhibitors Improve Heart Function and Prevent Fibrosis in Cardiomyopathy Caused by Mutation in Lamin A/C Gene
Circulation, January 4, 2011; 123(1): 53 - 61.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
M. P. van den Berg, K. Y. van Spaendonck-Zwarts, D. J. van Veldhuisen, J. A. Gietema, A. Postma, and J. P. van Tintelen
Familial dilated cardiomyopathy: another risk factor for anthracycline-induced cardiotoxicity?
Eur J Heart Fail, December 1, 2010; 12(12): 1297 - 1299.
[Full Text] [PDF]


Home page
Eur J Heart FailHome page
J. P. van Tintelen, K. Y. van Spaendonck-Zwarts, and M. P. van den Berg
Lamin A/C-related cardiac disease and pregnancy
Eur J Heart Fail, June 1, 2010; 12(6): 532 - 534.
[Full Text] [PDF]


Home page
CirculationHome page
K. Y. van Spaendonck-Zwarts, J. P. van Tintelen, D. J. van Veldhuisen, R. van der Werf, J. D. H. Jongbloed, W. J. Paulus, D. Dooijes, and M. P. van den Berg
Peripartum Cardiomyopathy as a Part of Familial Dilated Cardiomyopathy
Circulation, May 25, 2010; 121(20): 2169 - 2175.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
j.jacc.2007.02.063v1
49/25/2430    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Tintelen, J. P.
Right arrow Articles by Pinto, Y. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Tintelen, J. P.
Right arrow Articles by Pinto, Y. M.
Related Collections
Right arrowRelated Article

 
  CME Topic Collections Past Issues Search Current Issue Home

Advertisement