|
| HOME | SUBSCRIPTIONS | CURRENT ISSUE | PAST ISSUES | CARDIOSOURCE | SEARCH | HELP | FEEDBACK |
|
|
|
|||||||||
|
|||||||||||
|
J Am Coll Cardiol, 2006; 47:2536-2544, doi:10.1016/j.jacc.2006.01.071
(Published online 24 May 2006). © 2006 by the American College of Cardiology Foundation |
* Department of Pharmacology, Johannes Gutenberg University, Mainz, Germany
Department of Internal Medicine II, Johannes Gutenberg University, Mainz, Germany
Institute of Pharmacology and Toxicology, Faculty of Clinical Medicine Mannheim, Ruprecht Karls University Heidelberg, Mannheim, Germany
Manuscript received December 15, 2005; revised manuscript received January 13, 2006, accepted January 17, 2006.
* Reprint requests and correspondence: Dr. Huige Li, Department of Pharmacology, Johannes Gutenberg University, Obere Zahlbacher Strasse 67, D-55131 Mainz, Germany. (Email: HuigeLi{at}mail.Uni-Mainz.de).
 |
Abstract |
|---|
 Top Abstract MethodsResultsDiscussionReferences |
|---|
BACKGROUND: Many cardiovascular diseases are associated with oxidant stress involving protein kinase C (PKC) and uncoupling of eNOS.
METHODS: Messenger ribonucleic acid (mRNA) expression was analyzed with RNase protection assay or quantitative real-time polymerase chain reaction, vascular nitric oxide (NO) with spin trapping, and reactive oxygen species (ROS) with dihydroethidium fluorescence.
RESULTS: Aortas of spontaneously hypertensive rats (SHR) showed an elevated production of ROS when compared with aortas of Wistar-Kyoto rats (WKY). The aortic expression of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase subunits (Nox1, Nox2, Nox4, and p22phox) was higher in SHR compared with WKY. In SHR, aortic production of ROS was reduced by the NO synthase inhibitor NG-nitro-L-arginine methyl ester (L-NAME), indicating eNOS "uncoupling" in hypertension. Oral treatment with the PKC inhibitor midostaurin reduced aortic Nox1 expression, diminished ROS production, and reversed eNOS uncoupling in SHR. Aortic levels of (6R)-5,6,7,8-tetrahydro-L-biopterin (BH4) were significantly reduced in SHR compared with WKY. Midostaurin normalized BH4 levels in SHR. In both WKY and SHR, midostaurin increased aortic expression of eNOS mRNA and protein, stimulated bioactive NO production, and enhanced relaxation of the aorta to acetylcholine. Midostaurin lowered blood pressure in SHR and, to a lesser extent, in WKY; the compound did not change blood pressure in WKY made hypertensive with L-NAME.
CONCLUSIONS: Pharmacologic interventions that combine eNOS up-regulation and reversal of eNOS uncoupling can markedly increase bioactive NO in the vasculature and produce beneficial hemodynamic effects such as a reduction of blood pressure.
| ||||||||||||||
The NO released from endothelial cells has an important role in controlling blood pressure. Blockade of NO synthesis with pharmacologic NO synthase inhibitors causes significant peripheral vasoconstriction and elevation of blood pressure (5,6). Mice with a disrupted eNOS gene are hypertensive and lack endothelium-dependent NO-mediated vasodilation (7).
Given the beneficial effects of endothelial NO, enhancement of NO production by up-regulating eNOS expression could be of prophylactic or therapeutic interest. However, overexpression of eNOS has been associated with enzyme dysfunction in several models. Under these conditions, eNOS generates reactive oxygen species (ROS) at the expense of NO (8,9). This has been referred to as eNOS "uncoupling" (10). Interestingly, protein kinase C (PKC) inhibitors have been shown to reduce oxidative stress in the vasculature in vivo and to prevent eNOS uncoupling in a model of angiotensin II-induced hypertension (11).
The PKC inhibitor midostaurin (4'-N-benzoyl staurosporine, CGP 41251, PKC-412) is an orally active small molecule that has advanced to latter-stage clinical development for cancer and/or other indications (12). Previous work from our laboratory has indicated that midostaurin and related compounds increase eNOS expression in cultured human vascular endothelial cells independent of PKC inhibition (13). We hypothesized that a compound with an action profile combining PKC inhibition and eNOS up-regulation should markedly elevate the amount of bioactive NO in the vasculature. The current study was designed to investigate this hypothesis in spontaneously hypertensive rats (SHR) in vivo.
|
Methods |
|---|
|
TopAbstractMethodsResultsDiscussionReferences |
|---|
Midostaurin, formulated as 16% (w/w) preparation in Gelucire 44/14, and Gelucire 44/14 itself were provided by Novartis Pharma AG (Basel, Switzerland). The rats were treated intragastrically by gavage for 5 days with 75 mg/kg/day midostaurin or the control substance Gelucire 44/14.
RNase protection assay for eNOS messenger ribonucleic acid (mRNA) analyses. Total ribonucleic acid (RNA) was isolated from rat aorta by guanidinium thiocyanate-phenol-chloroform extraction. Endothelial NO synthase mRNA was analyzed with RNase protection assays as described previously (14).
Immunohistochemistry analysis of eNOS protein in aorta. Aortic segments from control SHR and SHR treated with midostaurin (75 mg/kg/day for 5 days) were frozen in Tissue-Tek (Sakura, Heppenheim, Germany). Cryostat sections were stained for eNOS using the Animal Research Kit (ARK, DAKO, Hamburg, Germany). The mouse monoclonal anti-eNOS antibody was from BD Transduction Laboratories (Heidelberg, Germany). Briefly, the primary mouse antibody was biotinylated and incubated with the tissue specimens, followed by an incubation with streptavidin-peroxidase. The reaction was visualized with 3,3'-diaminobenzidine.
Measurement of aortic ROS production by L-012 chemiluminescence. Vascular ROS production was determined using the luminol derivative L-012 [8-amino-5-chloro-7-phenylpyridol[3,4-d]pyridazine-1,4(2H,3H)dione] (15–17). Briefly, aortas from untreated SHR, control WKY, midostaurin-treated SHR (75 mg/kg/day for 5 days), and midostaurin-treated WKY were isolated, cut into 3-mm rings, and incubated for 30 min at 37°C in 96-well plates in Hanks’ balanced salt solution (PAA Laboratories, Cölbe, Germany) containing 100 µmol/l L-012, with or without the NO synthase inhibitor NG-nitro-L-arginine methyl ester (L-NAME, 1 mmol/l). Then, L-012–derived chemiluminescence was measured using a Microplate Luminometer (Berthold, Bad Wildbad, Germany). The photon counts were normalized for the dry weight of aortic tissue.
Measurement of vascular superoxide production by dihydroethidium fluorescence. The oxidative fluorescent dye dihydroethidium was used to evaluate the amount of superoxide in situ as described previously (11,18). After treatment with midostaurin (75 mg/kg/day) for 5 days, aortas were harvested and 10 µm frozen sections were prepared. The sections were then allowed to thaw and were incubated with 10 µmol/l dihydroethidium. Dihydroethidium is cell permeable and reacts with superoxide to form ethidium, which in turn intercalates in the deoxyribonucleic acid, thereby exhibiting a red fluorescence. Photographs were taken using a fluorescent microscope at an excitation wavelength of 520 nm and an emission wavelength of 610 nm. To analyze the potential contribution of eNOS to ROS production, some sections were preincubated with L-NAME (1 mmol/l) for 30 min. Autofluorescence of the elastic laminae was detected using a green filter.
RT-PCR for mRNA expression of NADPH oxidase subunits. The mRNA expression of NADPH oxidase (Nox) subunits was analyzed with quantitative RT-PCR using an iCycler iQ System (Bio-Rad Laboratories, Munich, Germany). Total RNA was isolated from aortas of WKY and SHR. We used 0.5 µg of total RNA for RT-PCR analysis with the QuantiTec probe RT-PCR kit (Qiagen, Hilden, Germany). Sequences of used primers and of the TaqMan probes were (forward, reverse, and probe) GCTGGCCTTACTGGAGTGGTC, TCCTGCGGATAAACTCCATAGC, and CCACTGTGGCTTTGGTTCTCATGGTAACTT for Nox1; CTTCTTGGGTCAGCACTGGC, GCAGCAAGATCAGCATGCAG, and CACCTGCAGCCTGCCTGAATTTCA for Nox2 (gp91phox); CTGTCCTGAACCTCAACTGCAG, TGTGATCCGCGAAGGTAAGC, and CTTTTACCCATGTGCCGCACAGTCCT for Nox4; TACCTGACCGCTGTGGTGAAG, GCAGTAAGTGGAGGACAGCCC, and TGTTCGGGCCCCTCACCAGAAATTAC for p22phox; and TTCTTGTGCAGTGCCAGCC, CGTCCGATACGGCCAAATC, and TCTCATAGACAAGATGGTGAAGGTCGGTGT for GAPDH.
Measurement of vascular content of (6R)-5,6,7,8-tetrahydro-L-biopterin (BH4). After treatment with midostaurin (75 mg/kg/day) for 5 days, aortas were isolated and homogenized in ice-cold lysis buffer (0.1 mol/l Tris-HCl, pH 7.8, containing 5 mmol/l ethylenediamin tetraacetic acid, 0.3 mol/l KCl, 5 mmol/l 1,4-dithioerythritol, 0.5 mM Pefabloc, and 0.01% saponin). Samples were oxidized under either acidic conditions (with 0.2 mol/l HCl containing 50 mmol/l I2) or alkaline conditions (with 0.2 mol/l NaOH containing 50 mmol/l I2). Biopterin content was assessed using high-performance liquid chromatography with fluorescence detection (350 nm excitation, 450 nm emission). BH4 concentration was calculated as fmol/µg protein by subtracting the biopterin peak resulting from alkaline oxidation (accounting for BH2) from the biopterin peak resulting from acidic oxidation (accounting for both BH2 and BH4).
Spin trapping of aortic NO using colloid Fe(DETC)2. Segments from rat thoracic aorta (10 mm) were cut into 3-mm rings and incubated at 37°C for 30 min in Krebs solution in the presence of 1 µmol/l acetylcholine and 200 µmol/l colloid Fe(DETC)2 as described previously (11,19). Electron paramagnetic resonance studies were performed on a tabletop X-band spectrometer Miniscope (Magnettech, Berlin, Germany). Recordings were made at 77 K using a Dewar flask (Wilmad, Buena, New Jersey). Instrument settings were 10 mW of microwave power, 1 mT of amplitude modulation, 100 kHz of modulation frequency, and 60 s of sweep time. Samples were scanned 10 times.
Determination of total NO synthesis as nitrite/nitrate in rat serum. Oxidation products of NO (nitrite and nitrate) were assayed in rat serum as a measure of total NO synthesis using a NOA 280 Nitric Oxide Analyzer (Sievers, Boulder, Colorado) after enzymatic reduction with nitrate reductase (20,21).
Organ chamber experiments using rat aorta. After 5 days of treatment with midostaurin or Gelucire 44/14, aortas were isolated from 12 WKY and 18 SHR, cut into 3-mm rings, set up in organ chambers, and precontracted with 100 nmol/l norepinephrine. Endothelium-dependent vasodilator responses to acetylcholine were determined in the absence or presence of L-NAME (1 mmol/l).
Telemetric measurement of blood pressure. In 18 conscious WKY and 18 SHR, systolic and diastolic blood pressure as well as heart rate were measured telemetrically with implanted transmitter-coupled pressure transducers in the abdominal aorta as described (22). The rats first received Gelucire 44/14 (vehicle) for one week and, after a washout period of another week, midostaurin for an additional week. Additional WKY were treated with L-NAME 24 mg/kg/day before and during midostaurin treatment.
Statistics. Analysis of variance (ANOVA) for repeated measures was used to analyze the curves for the vascular relaxation studies in the organ bath. Other differences were tested for statistical significance by ANOVA followed by Fisher protected least-significant-difference test.
|
Results |
|---|
|
TopAbstractMethodsResultsDiscussionReferences |
|---|
|
|
In WKY rats, midostaurin also had no significant effect on the expression of NADPH oxidase (Fig. 2), which mirrored its missing effect on aortic ROS production.
In contrast, midostaurin treatment of SHR for 5 days (75 mg/kg/day) markedly reduced mRNA expression of Nox1 (Fig. 2), a major source of ROS in the vasculature (11,23,24). Midostaurin had no significant effect on the expression of Nox2, Nox4, or p22phox in SHR (Fig. 2).
In midostaurin-treated SHR, L-NAME no longer reduced aortic ROS production (Fig. 1), demonstrating a reversal of eNOS uncoupling by the PKC inhibitor.
Treatment with midostaurin increased vascular BH4 levels in SHR. The aortic levels of BH4 were lower in SHR than in WKY. Midostaurin treatment (75 mg/kg/day) for 5 days significantly increased the BH4 content in the aorta of SHR (Fig. 3).
|
|
|
|
|
Midostaurin treatment lowered blood pressure in SHR and WKY, but not in L-NAME-treated WKY. Vehicle (Gelucire 44/14) treatment had no effect on blood pressure development in SHR (Fig. 8A; a slight increase was also seen in untreated SHR). Treatment with midostaurin resulted in a reduction of blood pressure (Fig. 8A). Blood pressure dropped significantly within 24 h of the first dose. The reduction reached a maximum after 48 h and was maintained at this level. This decrease in blood pressure seemed to result from eNOS recoupling and enhanced eNOS expression rather than direct activation of the enzyme, because acute infusion of midostaurin into SHR (for 20 min) produced no decrease in blood pressure (data not shown). The effect of long-term treatment with midostaurin on blood pressure was reversible; blood pressure increased again when midostaurin was withdrawn (Fig. 8A). Midostaurin treatment also lowered blood pressure in WKY, although to a lesser extent (Fig. 8B).
|
|
Discussion |
|---|
|
TopAbstractMethodsResultsDiscussionReferences |
|---|
Cardiovascular diseases, such as hypertension, hypercholesterolemia, and atherosclerosis, are often associated with PKC activation and increased oxidative stress in the vasculature (10). Under these conditions, eNOS can become dysfunctional and uncoupled, producing ROS instead of NO. Such an eNOS uncoupling has been shown to be the major mechanism for endothelial dysfunction observed in vascular diseases, including angiotensin II-induced hypertension, streptozotocin-induced diabetes, and nitrate tolerance (11,14,25). Oxidation of BH4 owing to vascular oxidative stress has been shown to cause BH4 deficiency (26). BH4 is an essential cofactor for eNOS, and a lack of BH4 seems to play a crucial role in eNOS uncoupling (27–29).
Numerous enzyme systems can potentially produce ROS in the vessel wall; however, four enzyme systems seem to predominate. These include the NADPH oxidases, xanthine oxidase, mitochondrial sources, and uncoupled eNOS (30). Interestingly, there appears to be substantial interplay among these sources, such that activation of one can enhance activity of others. Especially the Nox isoforms seem to be upstream of an activation of other ROS-producing enzymes, because the Nox-derived superoxide has been implicated in the activation of xanthine oxidase and in eNOS uncoupling (31).
In the current study, we analyzed the expression of Nox in the aorta of SHR and found that Nox1, Nox2, Nox4, and p22phox were up-regulated compared with WKY. This may be responsible for the observed oxidative stress in these hypertensive animals. An up-regulation of p22phox in SHR has also been reported in a previous study (32).
In SHR, but not in WKY, treatment with midostaurin markedly reduced the (enhanced) expression of Nox1, but left the other Nox isoforms (subunits) unchanged. Nox1 down-regulation by midostaurin seems to be PKC-dependent, because a similar down-regulation has been observed with other PKC inhibitors such as chelerythrine (11). Nox1 has been established as a major source of ROS in animal models of hypertension (11,23,24). Accordingly, in the current study the down-regulation of Nox1 by midostaurin was associated with a reduced aortic ROS production and a reversal of eNOS uncoupling in SHR. The main reason for this "recoupling" of eNOS could be an elevation of vascular BH4 content (Fig. 3) owing to reduced BH4 oxidation.
Interestingly, midostaurin also increases eNOS gene expression. We have previously demonstrated the same effect in cultured human endothelial cells. Midostaurin-induced eNOS expression is a transcriptional event, because midostaurin increases eNOS promoter activity and has no effect on eNOS mRNA stability (13). The mechanism underlying the midostaurin-induced stimulation of eNOS promoter activity is not clear at this time, but it is independent of the inhibitory effect of the compound on PKC, cAMP-dependent kinase (PKA), cGMP-dependent kinase (PKG), or tyrosine kinases (13). Also, Rho kinase is unlikely to be involved. Rho kinase negatively regulates eNOS mRNA stability by changes in the endothelial actin cytoskeleton (33). Because eNOS mRNA stability is not changed by midostaurin, the effect of midostaurin on eNOS expression is likely to be independent of Rho kinase.
Here we show that such an eNOS up-regulation also occurs in vivo. This also contributes to the observed increase in NO production in vivo and the enhanced vasodilator response to acetylcholine ex vivo. The blood pressure reduction seen in SHR is mediated by a functional and up-regulated eNOS, because the effect is not seen in L-NAME-treated WKY. Also, in apolipoprotein E-knockout mice, treatment with midostaurin increased the expression of eNOS in the vasculature, and the eNOS enzyme was in a functional state (34). The up-regulation of a functional eNOS enzyme was associated with a dilation of resistance arterioles, which is in agreement with the blood pressure lowering effect of midostaurin (34).
Owing to the antithrombotic, antiatherosclerotic, and antihypertensive properties of endothelial NO, the eNOS enzyme could be an interesting target for the prevention or therapy of cardiovascular diseases (10,35). However, a simple up-regulation of eNOS gene expression and/or enzyme activity could be detrimental, because eNOS is often uncoupled under pathologic conditions. An up-regulation of uncoupled eNOS would boost the pre-existing oxidative stress, as has been reported for eNOS-transgenic mice on an apolipoprotein E-knockout background (36).
A more realistic strategy for eNOS-related treatment of vascular disease may be the reversal of eNOS uncoupling. Midostaurin is a compound that achieves this goal by inhibiting PKC. We have previously shown in other animal models that PKC inhibition successfully reduced ROS production, reversed eNOS uncoupling, and reestablished endothelial function (11,14). In a rat model of angiotensin II-induced hypertension, we used the PKC inhibitor chelerythrine (11), and in the rat model of streptozotocin-induced diabetes, we used midostaurin at a dose of 10 mg/kg/day (14). This dose is high enough to inhibit PKC but insufficient to up-regulate eNOS expression.
In cardiovascular diseases, eNOS is often found up-regulated (10). This can be considered an attempt of the organism to compensate for NO deficiency. The attempt usually fails because the up-regulated eNOS uncouples. Activation of PKC seems to play a crucial role in eNOS up-regulation in disease states (as it does in eNOS uncoupling, as shown earlier) (10,37). Consequently, the PKC inhibitors, although restoring eNOS enzymatic function, reduced eNOS expression (14). The result was a functional eNOS but low NO production (14).
This predicament is not encountered with midostaurin. At higher doses, the compound increases eNOS expression in addition to restoring eNOS functionality (via PKC inhibition) (13). Both the (PKC-independent) eNOS up-regulation and the (PKC-dependent) eNOS "recoupling" contribute to the enhanced production of bioactive NO and thus the beneficial effects of midostaurin in vascular pathophysiology. In three previous in vivo studies, three different PKC inhibitors other than midostaurin have been used (11,38,39). None of these compounds had any effect on eNOS expression (13,37), and none changed vascular tone or blood pressure. In a study by Chrissobolis and Sobey (38) with chronically hypertensive rats, PKC inhibition with Ro 31-8220 did not significantly affect basilar artery diameter; in a rat diabetes model, PKC inhibition with LY333531 did not reduce hypertension, although it attenuated the progression of diabetic nephropathy (39).
In conclusion, we postulate the following sequence of events for the action of midostaurin in SHR. Midostaurin reduces Nox1 expression (Fig. 2) and thus ROS generation (Fig. 1). This in turn enhances BH4 levels (Fig. 3) and lets eNOS regain its normal function ("recoupling") (Fig. 1). Bioactive NO is being produced again, and its production is further increased by the concurrent stimulation of eNOS gene expression (Figs. 4 and 5). This combination of effects leads to blood pressure reduction in SHR.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
|
References |
|---|
|
TopAbstractMethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  H. Li, M. Hortmann, A. Daiber, M. Oelze, M. A. Ostad, P. M. Schwarz, H. Xu, N. Xia, A. L. Kleschyov, C. Mang, et al. Cyclooxygenase 2-Selective and Nonselective Nonsteroidal Anti-Inflammatory Drugs Induce Oxidative Stress by Up-Regulating Vascular NADPH Oxidases J. Pharmacol. Exp. Ther., September 1, 2008; 326(3): 745 - 753. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Wohlfart, H. Xu, A. Endlich, A. Habermeier, E. I. Closs, T. Hubschle, C. Mang, H. Strobel, T. Suzuki, H. Kleinert, et al. Antiatherosclerotic Effects of Small-Molecular-Weight Compounds Enhancing Endothelial Nitric-Oxide Synthase (eNOS) Expression and Preventing eNOS Uncoupling J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 370 - 379. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. E. Broderick, L. Alvarez, M. Balasubramanian, D. D. Belke, A. Makino, A. Chan, V. L. Woods Jr., W. H. Dillmann, V. S. Sharma, R. B. Pilz, et al. Nitrosyl-Cobinamide, a New and Direct Nitric Oxide Releasing Drug Effective In Vivo Experimental Biology and Medicine, December 1, 2007; 232(11): 1432 - 1440. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Li and H. E. Schellhorn New Developments and Novel Therapeutic Perspectives for Vitamin C J. Nutr., October 1, 2007; 137(10): 2171 - 2184. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Xu, Y. Wu, P. Song, M. Zhang, S. Wang, and M.-H. Zou Proteasome-Dependent Degradation of Guanosine 5'-Triphosphate Cyclohydrolase I Causes Tetrahydrobiopterin Deficiency in Diabetes Mellitus Circulation, August 21, 2007; 116(8): 944 - 953. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Steinkamp-Fenske, L. Bollinger, H. Xu, Y. Yao, S. Horke, U. Forstermann, and H. Li Reciprocal Regulation of Endothelial Nitric-Oxide Synthase and NADPH Oxidase by Betulinic Acid in Human Endothelial Cells J. Pharmacol. Exp. Ther., August 1, 2007; 322(2): 836 - 842. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Horke, I. Witte, P. Wilgenbus, M. Kruger, D. Strand, and U. Forstermann Paraoxonase-2 Reduces Oxidative Stress in Vascular Cells and Decreases Endoplasmic Reticulum Stress-Induced Caspase Activation Circulation, April 17, 2007; 115(15): 2055 - 2064. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | SUBSCRIPTIONS | CURRENT ISSUE | PAST ISSUES | CARDIOSOURCE | SEARCH | HELP | FEEDBACK |
