Advertisement






Click here for more guidelines.
CME Topic Collections Past Issues Search Current Issue Home
     

J Am Coll Cardiol, 2005; 46:1516-1520, doi:10.1016/j.jacc.2005.06.066 (Published online 22 September 2005).
© 2005 by the American College of Cardiology Foundation
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
j.jacc.2005.06.066v1
46/8/1516    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Frikke-Schmidt, R.
Right arrow Articles by Tybjærg-Hansen, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Frikke-Schmidt, R.
Right arrow Articles by Tybjærg-Hansen, A.

CLINICAL RESEARCH: CORONARY ARTERY DISEASE

Mutation in ABCA1 Predicted Risk of Ischemic Heart Disease in the Copenhagen City Heart Study Population

Ruth Frikke-Schmidt, MD, PhD*, Børge G. Nordestgaard, MD, DMSc{dagger},{ddagger}, Peter Schnohr, MD{ddagger}, Rolf Steffensen, MD§ and Anne Tybjærg-Hansen, MD, DMSc{ddagger},*

* Department of Clinical Biochemistry, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark
{dagger} Department of Clinical Biochemistry, Herlev University Hospital, Herlev, Denmark
{ddagger} The Copenhagen City Heart Study, Bispebjerg University Hospital, Bispebjerg, Denmark
§ Department of Medicine B, Hillerød Hospital, Hillerød, Denmark

Manuscript received January 27, 2005; revised manuscript received June 16, 2005, accepted June 20, 2005.

* Reprint requests and correspondence: Dr. Anne Tybjaerg-Hansen, Department of Clinical Biochemistry KB 3011, Section for Molecular Genetics, Rigshospitalet, Copenhagen University Hospital, Blegdamsvej 9, DK-2100 Copenhagen Ø, Denmark. (Email: at-h{at}rh.dk).


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
OBJECTIVES: We tested whether heterozygosity for the K776N mutation (frequency: 0.4%) in ATP-binding cassette transporter A1 (ABCA1) predicted ischemic heart disease (IHD) in the Copenhagen City Heart Study population.

BACKGROUND: In a complex trait like IHD, genetic variation is considered to be conferred by common DNA polymorphisms, although rare mutations may have a larger impact. Tangier disease, a rare high-density lipoprotein cholesterol (HDL-C) deficiency syndrome with IHD, is caused by homozygous ABCA1 mutations.

METHODS: We analyzed blood samples from a large cohort study of 9,076 Danish individuals followed for 24 years (167,287 person-years), during which 1,033 incident IHD events occurred. The hypothesis was retested in an independent case-control study comparing 562 IHD patients with 3,103 controls.

RESULTS: The cumulative incidence of IHD as a function of age was increased in K776N heterozygotes compared with non-carriers (log-rank test: p = 0.005). At the age of 80 years, 48% of heterozygotes and 23% of non-carriers had IHD. Incidence rates in non-carriers and K776N heterozygotes were 61 and 157 per 10,000 person-years. The age-adjusted hazard ratio for IHD in K776N heterozygotes versus non-carriers was 2.4 (95% confidence interval 1.3 to 4.5). Adjusting for HDL-C, or for smoking, diabetes, and hypertension did not change the result, suggesting that genotype predicted risk of IHD beyond that offered by HDL-C, and by other conventional risk factors. Similar trends were obtained in an independent case-control study.

CONCLUSIONS: Heterozygosity for an ABCA1 mutation (K776N) conferred two- to three-fold risk of IHD in 37 participants in the Copenhagen City Heart study.

Abbreviations and Acronyms
  apoAI = apolipoprotein AI
  CFTR = cystic fibrosis transmembrane conductance regulator
  HDL-C = high-density lipoprotein cholesterol
  IHD = ischemic heart disease


The understanding of the genetic contribution to ischemic heart disease (IHD), the most common cause of death in developed countries (1), is very limited. Rare mutations in the heterozygous or homozygous state are known to cause familial hypercholesterolemia (2); however, the major genetic contribution to IHD is generally considered to be conferred by common DNA polymorphisms. Alternatively, rare mutations independent of plasma cholesterol levels may have a considerable impact on IHD risk (3).

The ATP-binding cassette transporter AI (ABCA1) is crucial in the initial step of high-density lipoprotein (HDL) formation and in reverse cholesterol transport. Tangier disease, a rare HDL deficiency syndrome (4–6) associated with an increased risk of IHD, is caused by homozygous ABCA1 mutations. Genetic variation in several other genes such as apolipoprotein AI (apoAI), apolipoprotein E, lecithin cholesteryl acyltransferase, lipoprotein lipase, hepatic lipase, and cholesteryl ester transfer protein are known to influence HDL cholesterol levels (7,8). We and others have recently shown that rare ABCA1 variants contribute to HDL-C levels in the general population (9,10). Thus, heterozygosity for mutations in ABCA1 may influence risk of IHD in individuals in the general population.

Functional defects of mutations in Tangier disease and hypoalphalipoproteinemia have been extensively tested and verified in studies of apoAI cross-linking, cholesterol efflux, and intracellular signal trafficking (10–12). The K776 residue is localized in the middle of the ABCA1 protein in a domain that is predicted to be either transmembrane or very close to the extracellular surface (13); very little is known about the functionality of this exact area. The K776N mutation is of particular interest because: 1) K776 is completely conserved between species; 2) the K > N amino acid substitution results in a change in side chain charge (basic to uncharged polar); 3) K776N is reported to be relatively frequent in Caucasians (3 per 1,000) (14); 4) disease-causing mutations have been identified in the corresponding region of a closely related gene, the cystic fibrosis transmembrane conductance regulator (CFTR or ABCC7) (15).

We tested the hypothesis that ABCA1 K776N genotype is associated with risk of IHD in the general population. This was studied using blood samples from 9,076 Danish individuals followed for 24 years (167,287 person-years), during which 1,033 incident IHD events occurred. Further, the hypothesis was retested in an independent case-control study comparing 562 IHD patients with 3,103 healthy controls.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Participants.   The Copenhagen City Heart Study is a large cohort study of the Danish general population initiated in 1976 to 1978 with follow-up examinations in 1981 to 1983 and 1991 to 1994 (16,17). At the third examination (1991 to 1994), 16,563 individuals were invited, 10,135 participated (response rate 61%), and clinical and laboratory data, DNA, and genotype information was available on 9,140. Informed consent was obtained from all participants, of which more than 99% were white and of Danish descent. The study was approved by the Danish Ethics Committee for the City of Copenhagen and Frederiksberg (No. 100.2039/91). To begin to verify the findings in the cohort study, 562 patients (45 to 64 years old) with IHD verified by coronary angiography at Department of Cardiology, Copenhagen University Hospital, Rigshospitalet, were compared with 3,103 healthy controls within the same age range.

Study designs.   The 9,140 participants were followed from entry at the first (1976 to 1978), second (1981 to 1983), or third (1991 to 1994) examinations, and until end of follow-up, December 31, 1999. Information on diagnoses of IHD (World Health Organization International Classification of Diseases, 8th edition, codes 410 to 414; 10th edition, I20 to I25) was gathered until 1999 from the Danish National Hospital Discharge Register, from the Danish National Register of Causes of Death, and from medical records of general practitioners and hospitals. Of the 1,097 participants recorded with IHD, 64 were diagnosed before entry into the Copenhagen City Heart Study and were excluded, leaving 1,033 incident IHD cases, and a total of 9,076 individuals for all further analyses. Median follow-up time was 22 years (range, 0.04 to 24 years), representing 167,287 person-years. Follow-up was >99.9% complete.

Risk factors for IHD (i.e., diabetes mellitus, smoking, and hypertension) were dichotomized and defined as ever-diabetics (self-reported disease, use of insulin, use of oral hypoglycemic drugs, and/or non-fasting plasma glucose ≥11.1 mmol/l at any of the three examinations), ever-smokers (ex-smoker or current smoker at any of the three examinations), ever-hypertensive (systolic blood pressure ≥140 mm Hg or diastolic blood pressure ≥90 mm Hg or use of antihypertensive drugs at any of the three examinations).

DNA analyses.   An ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, California) was used to genotype the K776N (nucleotide 2327G > C) mutation. TaqMan Universal PCR Master Mix (Applied Biosystems), wild-type and mutation-specific TaqMan probes (wild-type reporter probe: VIC-CACTCAAGATCTTCGC, mutation reporter probe: FAM-ACTCAACATCTTCGC), and one pair of polymerase chain reaction primers were used (forward: 5'TGTGGCATGGCAGGACTAC, reverse: 5'AGAAAGGCCAGAGGTACTCACA). A perfectly hybridized probe is cleaved by the 5'nuclease activity of Taq polymerase, releasing the 3'quencher linked to the probe, and resulting in a probe-specific increase in fluorescence. The assay was obtained from the Assay-by-Design Service using the Assay-by-Design File Builder software from Applied Biosystems.

Other analyses.   Colorimetric and turbidimetric assays were used to measure plasma levels of total cholesterol, HDL-C, triglycerides, and apolipoproteins B and AI (all Boehringer Mannheim, Mannheim, Germany).

Statistical analyses.   We used the statistical software package Stata (STATA Corp., College Station, Texas). Two-sided probability values <0.05 were considered significant. Pearson chi-square test and Student t test were used for two-group comparisons. Cox proportional hazards regression models estimated hazard ratios for IHD as a function of K776N genotype, and Kaplan-Meier plots and log-rank tests evaluated the cumulative incidence of IHD as a function of age and K776N genotype. For all survival statistics, age was the time scale using left truncation (or delayed entry). When age is used with left truncation, it implies that age is automatically adjusted for, and therefore not included as a covariate in the model (18). The assumption of proportional hazard ratios was checked by visual inspection of graphs of the log of the cumulative hazard function in the exposed and unexposed groups. If these graphs for the exposed and unexposed groups are parallel, the assumption is not violated. Smoking, diabetes, and hypertension dichotomized, and HDL-C in tertiles were forced into the regression models. Hazard ratios are presented for heterozygotes versus non-carriers, because no homozygotes were identified. Logistic regression analysis adjusted for age in 10-year age groups estimated odds ratio for IHD in the case-control study.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Among the 9,076 participants in The Copenhagen City Heart Study, 37 (frequency: 0.4%) were heterozygous and none were homozygous for K776N. Genotype frequencies did not differ from those predicted by the Hardy-Weinberg equilibrium (p = 0.85). Risk factors for IHD did not differ between non-carriers and K776N heterozygotes, except for levels of HDL-C in men (Table 1). The cumulative incidence of IHD as a function of age was increased in K776N heterozygotes compared with non-carriers (log-rank test: p = 0.005) (Fig. 1). At the age of 80 years, about 48% of heterozygotes and 23% of non-carriers had IHD. Incidence rates in non-carriers and K776N heterozygotes were 61 and 157 per 10,000 person-years (Table 2). The age-adjusted hazard ratio for IHD in K776N heterozygotes versus non-carriers was 2.4 (95% confidence interval 1.3 to 4.5) (Table 2). Adjusting for HDL-C, or for smoking, diabetes, and hypertension did not substantially change the hazard ratio, suggesting that genotype predicted risk of IHD beyond that offered by HDL-C, and by other conventional risk factors. Finally, in an independent case-control study comparing 562 patients with IHD with 3,103 healthy controls within the same age range, the odds ratio for IHD in K776N heterozygotes versus non-carriers was 2.8 (95% confidence interval 0.8 to 9.4) (Table 3).


View this table:
[in this window]
[in a new window]
 
Table 1. Characteristics of Individuals in the General Population by ABCA1 K776N Genotype
 


View larger version (14K):
[in this window]
[in a new window]
 
Figure 1 Cumulative incidence of ischemic heart disease (IHD) as a function of age and ABCA1 K776N genotype.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Risk of Ischemic Heart Disease as a Function of ABCA1 K776N Genotype in the General Population
 

View this table:
[in this window]
[in a new window]
 
Table 3. Risk of Ischemic Heart Disease as a Function of ABCA1 K776N Genotype in the Case-Control Study
 
Mean plasma HDL-C in non-carriers and K776N heterozygotes was 1.72 mmol/l and 1.82 mmol/l in women (p = 0.42), and 1.38 mmol/l and 1.18 mmol/l in men (p = 0.05). Mean plasma apoAI levels in non-carriers and K776N heterozygotes were 151 mg/dl and 150 mg/dl in women (p = 0.93), and 130 mg/dl and 117 mg/dl in men (p = 0.03) (data not shown); HDL-C levels in the 37 individuals heterozygous for K776N ranged from 1.0 to 2.7 mmol/l in women, and from 0.5 to 2.0 mmol/l in men. Three of 19 women (16%), and 6 of 18 men (33%) had non-fasting triglycerides >2.2 mmol/l. Five of 19 women (26%) and 5 of 18 men (28%) had IHD; of these, one woman and one man had premature IHD, and two men had ischemic stroke.


    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
A total of 20% to 44% of Tangier disease patients have been reported to have cardiovascular disease compared with only 5% to 6% in control populations (19). Heterozygotes for Tangier disease do not have the classical Tangier symptoms caused by massive deposition of cholesteryl esters in various tissues, in particular tonsil anomalies and neuropathy are not characteristic. Biochemically heterozygotes are sometimes, but not always, characterized by half-normal serum concentrations of HDL-C, and by apoAI levels below the fifth percentile of sex-matched controls (20), but it is unclear at present whether heterozygotes for mutations in ABCA1 have an increased risk of IHD, and whether this risk is correlated to HDL-C levels. The frequency of IHD in K776N heterozygotes in the present study was 26% to 28% (women: 5 of 19; men: 5 of 18), comparable to the frequency in Tangier disease. A heterozygous mutation in ABCA1 in the Copenhagen City Heart Study population predicted risk of IHD independent of plasma HDL-C. The present study supports experimental evidence that ABCA1 may have antiatherosclerotic or anti-ischemic properties independent of plasma HDL-C (21–24). Thus, risk of IHD in individuals homozygote or heterozygote for mutations in ABCA1 may not only be related to levels of HDL-C in plasma, but may also depend on local effects of ABCA1 mutations in the arterial wall (21–23) or in platelets (24), promoting atherosclerosis.

The K776 residue is localized in the middle part of the ABCA1 protein in a fragment that is predicted to be either transmembrane, or very close to the extracellular surface (13). Very little is known about the functionality of this exact area. In contrast, the two major extracellular loops (11,12), the ATP-binding cassettes, a regulatory proline-glutamic acid-serine-threonine (PEST) sequence (residues 1283 to 1306) (25,26), and the C-terminal region have been extensively studied (27). A rare single nucleotide polymorphism (SNP) (V771M, allele frequency 0.03) and a mutation (T774P, allele frequency 0.004) situated, respectively, five and two amino acids N-terminal of the K776 residue, have been reported. Although we have recently shown that V771M is associated with increased HDL-C levels (9), effects on risk of IHD have not been documented for either of these variants (14,28). In contrast to the V771 and K776 residues, T774 is not conserved between species. The high degree of conservation of K776 between species and between human ABCAs with very different transport functions could indicate that this part of the protein is essential for normal function. To our knowledge, no homozygotes for K776N have been described so far, and we also did not identify any. Mean HDL-C levels in heterozygotes were 1.82 mmol/l (range: 1.0 to 2.7 mmol/l) in women, and 1.18 mmol/l (range: 0.5 to 2.0 mmol/l) in men. It is therefore unlikely that the majority of K776N homozygotes would express an HDL-C deficiency phenotype comparable to Tangier disease, where HDL-C levels are generally below 0.2 mmol/l. However, as is the case for K776N in the present study, in Tangier disease there also does not seem to be a clear correlation between the reduction in plasma HDL-C levels and risk of IHD. This is in agreement with previous studies that did not determine genetic variation in ABCA1 as strong predictors of HDL-C (9,14,29). A likely reason for this is that ABCA1 mainly affects pre-beta HDL, a type of HDL very poor in cholesterol content. However, this does not preclude an effect of genetic variants in ABCA1 on risk of IHD.

Although K776N is a relatively common mutation, it is not a common cause of IHD. The population-attributable fraction of K776N to IHD is about 0.4% in the Copenhagen City Heart Study, or comparable to the risk of IHD attributed to low-density lipoprotein receptor mutations in the same study. However, at the individual level, K776N appears to have a marked impact on risk.

As this is a novel observation, it may represent a chance finding. However, several arguments favor a true observation: 1) the involved amino acid residue is completely conserved between species and relatively conserved between 12 ABCAs with very different transport functions; 2) the amino acid substitution changes the charge of the side-chain, potentially leading to structural alterations of the protein, and consequently to altered protein interactions or transport properties; 3) in the CFTR (or ABCC7), a disease-causing mutation (R347P) has been identified at a site that corresponds to residue 764 in ABCA1 (15), and thus in close vicinity to K776N; 4) the present study is of a large cohort, and therefore includes only incident cases, avoiding the normal pitfalls of case reports and case-control studies (30); 5) we observed a similar trend on risk of IHD in a separate case-control study; 6) we have previously determined effects on lipids and lipoproteins of all non-synonymous SNPs identified in ABCA1 (R219K, V771M, V825I, I883M, E1172D, R1587K). When taking multiple testing into account, the log-rank test for the cumulative incidence of ischemic heart disease as a function of age and K776N genotype fulfilled a Bonferroni-corrected p value <0.007 (0.05 of 7) on a two-sided test (seven different genetic variants tested including K776N).

The fact that DNA samples were not obtained before the 1991 to 1994 examination is a source of potential bias. If mortality rate from ischemic heart disease was higher among K776N heterozygotes and homozygotes than among non-carriers, our study would underestimate the association between ABCA1 K776N and risk of ischemic heart disease. However, the fact that K776N was in Hardy-Weinberg equilibrium suggested that no serious selection bias had occurred in the cohort during follow-up.

This study demonstrated that heterozygosity for a common mutation in ABCA1 increased risk of IHD in the Copenhagen City Heart Study population, and predicted risk of IHD beyond traditional cardiovascular risk factors. Additional large cohort studies should address whether the present findings can be generalized to populations other than the Danish.


    Acknowledgments
 
The authors thank Mette Refstrup and Christina Dam for excellent technical assistance. The authors also thank the subjects who participated in the study.


    Footnotes
 
This study was supported by The Danish Heart Foundation, The Danish Medical Research Council, Ingeborg and Leo Dannin’s Grant, and The Research Fund at Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
1. Murray CJL, Lopez AD. Mortality by cause for eight regions of the worldGlobal Burden of Disease Study. Lancet 1997;349:1269-1276.[CrossRef][Web of Science][Medline]

2. Goldstein JL, Hobbs HH, Brown MS. Familial hypercholesterolemiaIn: Scriver CR, Beaudet AL, Sly WS, Valle D, editors. The Metabolic and Molecular Bases of Inherited Disease. 8th edition. New York, NY: McGraw-Hill; 2001. pp. 2863-2913.

3. Wang L, Fan C, Topol SE, Topol EJ, Wang Q. Mutation of MEF2A in an inherited disorder with features of coronary artery disease Science 2003;302:1578-1581.[Abstract/Free Full Text]

4. Bodzioch M, Orso E, Klucken J, et al. The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease Nat Genet 1999;22:347-351.[CrossRef][Web of Science][Medline]

5. Brooks-Wilson A, Marcil M, Clee SM, et al. Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency Nat Genet 1999;22:336-345.[CrossRef][Web of Science][Medline]

6. Rust S, Rosier M, Funke H, et al. Tangier disease is caused by mutations in the gene encoding ATP-binding cassette transporter 1 Nat Genet 1999;22:352-355.[CrossRef][Web of Science][Medline]

7. Tall AR, Breslow JL, Rubin EM. Genetic disorders affecting plasma high-density lipoproteinsIn: Scriver CR, Beaudet AL, Valle D, Sly WS, editors. The Metabolic and Molecular Bases of Inherited Disease. 8th edition. New York, NY: McGraw-Hill; 2001. pp. 2915-2936.

8. Frikke-Schmidt R, Nordestgaard BG, Agerholm-Larsen B, Schnohr P, Tybjaerg-Hansen A. Context dependent and invariant associations between lipids, lipoproteins, and apolipoproteins, and apolipoprotein E genotype. A study of 9,060 women and men from the population at large J Lipid Res 2000;41:1812-1822.[Abstract/Free Full Text]

9. Frikke-Schmidt R, Nordestgaard BG, Jensen GB, Tybjaerg-Hansen A. Genetic variation in ABC transporter A1 contributes to HDL-cholesterol in the general population J Clin Invest 2004;114:1343-1353.[CrossRef][Web of Science][Medline]

10. Cohen JC, Kiss RS, Pertsemlidis A, Marcel YL, McPherson R, Hobbs HH. Multiple rare alleles contribute to low plasma levels of HDL cholesterol Science 2004;305:869-872.[Abstract/Free Full Text]

11. Tanaka AR, Abe-Dohmae S, Ohnishi T, et al. Effects of Mutations of ABCA1 in the first extracellular domain on subcellular trafficking and ATP binding/hydrolysis J Biol Chem 2003;278:8815-8819.[Abstract/Free Full Text]

12. Fitzgerald ML, Morris AL, Rhee JS, Andersson LP, Mendez AJ, Freeman MW. Naturally occurring mutations in the largest extracellular loops of ABCA1 can disrupt its direct interaction with apolipoprotein A-I J Biol Chem 2002;277:33178-33187.[Abstract/Free Full Text]

13. Tanaka AR, Ikeda Y, Abe-Dohmae S, et al. Human ABCA1 contains a large amino-terminal extracellular domain homologous to an epitope of Sjogren’s syndrome Biochem Biophys Res Commun 2001;283:1019-1025.[CrossRef][Web of Science][Medline]

14. Clee SM, Zwinderman AH, Engert JC, et al. Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease Circulation 2001;103:1198-1205.[Abstract/Free Full Text]

15. Dean M, White MB, Amos J, et al. Multiple mutations in highly conserved residues are found in mildly affected cystic fibrosis patients Cell 1990;61:863-870.[CrossRef][Web of Science][Medline]

16. Appleyard M, Hansen AT, Jensen G, Schnohr P, Nyboe J. The Copenhagen City Heart Study. Øesterbroundersøgelsen. A book of tables with data from the first examination (1976–1978) and a five year follow-up (1981–1983). The Copenhagen City Heart Study Group Scand J Soc Med 1989;41(Suppl):1-160.

17. Schnohr P, Jensen G, Lange P, Scharling H, Appleyard M. The Copenhagen City Heart Study, Østerbroundersøgelsen, tables with data from the third examination 1991–1994 Eur Heart J 2001;3(Suppl H):1-83.[CrossRef]

18. Klein JP, Moeschberger ML. Refinements of the semiparametric proportional hazards model Survival Analysis. Techniques for Censored and Truncated Data. New York, NY: Springer-Verlag, Inc; 2003. pp. 295-328.

19. Serfaty-Lacrosniere C, Civeira F, Lanzberg A, et al. Homozygous Tangier disease and cardiovascular disease Atherosclerosis 1994;107:85-98.[CrossRef][Web of Science][Medline]

20. Assman G, von Eckardstein A, Bryan Brewer Jr H. Familial analphalipoproteinemiaTangier disease. In: Scriver CR, Beaudet AL, Valle D, Sly WS, editors. The Metabolic and Molecular Bases of Inherited Disease. 8th edition. New York, NY: McGraw-Hill; 2001. pp. 2937-2960.

21. Luciani MF, Chimini G. The ATP binding cassette transporter, ABC1, is required for engulfment of corpses generated by apoptotic cell death EMBO J 1996;15:226-235.[Web of Science][Medline]

22. Van Eck M, Bos IS, Kaminski WE, et al. Leukocyte ABCA1 controls susceptibility to atherosclerosis and macrophage recruitment into tissues Proc Natl Acad Sci U S A 2002;99:6298-6303.[Abstract/Free Full Text]

23. Joyce CW, Amar MJ, Lambert G, et al. The ATP binding cassette transporter A1 (ABCA1) modulates the development of aortic atherosclerosis in C57BL/6 and apoE-knockout mice Proc Natl Acad Sci U S A 2002;99:407-412.[Abstract/Free Full Text]

24. Schmitz G, Buechler C. ABCA1regulation, trafficking and association with heteromeric proteins. Ann Med 2002;34:334-347.[CrossRef][Web of Science][Medline]

25. Wang N, Chen W, Linsel-Nitschke P, et al. A PEST sequence in ABCA1 regulates degradation by calpain protease and stabilization of ABCA1 by apoA-I J Clin Invest 2003;111:99-107.[CrossRef][Web of Science][Medline]

26. Martinez LO, Agerholm-Larsen B, Wang N, Chen W, Tall AR. Phosphorylation of a pest sequence in ABCA1 promotes calpain degradation and is reversed by apoA-I J Biol Chem 2003;278:37368-37374.[Abstract/Free Full Text]

27. Buechler C, Boettcher A, Bared SM, Probst MC, Schmitz G. The carboxyterminus of the ATP-binding cassette transporter A1 interacts with a beta2-syntrophin/utrophin complex Biochem Biophys Res Commun 2002;293:759-765.[CrossRef][Web of Science][Medline]

28. Tregouet DA, Ricard S, Nicaud V, et al. In-depth haplotype analysis of ABCA1 gene polymorphisms in relation to plasma apoA1 levels and myocardial infarction Arterioscler Thromb Vasc Biol 2004;24:775-781.[Abstract/Free Full Text]

29. Kakko S, Kelloniemi J, von Rohr P, et al. ATP-binding cassette transporter A1 locus is not a major determinant of HDL-C levels in a population at high risk for coronary heart disease Atherosclerosis 2003;166:285-290.[CrossRef][Web of Science][Medline]

30. Collins FS. The case for a US prospective cohort study of genes and environment Nature 2004;429:475-477.[CrossRef][Medline]




This article has been cited by other articles:


Home page
JAMAHome page
L. R. Brunham, J. J. P. Kastelein, and M. R. Hayden
ABCA1 Gene Mutations, HDL Cholesterol Levels, and Risk of Ischemic Heart Disease
JAMA, November 5, 2008; 300(17): 1997 - 1998.
[Full Text] [PDF]


Home page
JAMAHome page
A. Tybjaerg-Hansen, B. G. Nordestgaard, and R. Frikke-Schmidt
ABCA1 Gene Mutations, HDL Cholesterol Levels, and Risk of Ischemic Heart Disease--Reply
JAMA, November 5, 2008; 300(17): 1998 - 1998.
[Full Text] [PDF]


Home page
J Am Coll CardiolHome page
M. C.A. Stene, R. Frikke-Schmidt, B. G. Nordestgaard, P. Grande, P. Schnohr, and A. Tybjaerg-Hansen
Functional Promoter Variant in Zinc Finger Protein 202 Predicts Severe Atherosclerosis and Ischemic Heart Disease
J. Am. Coll. Cardiol., July 29, 2008; 52(5): 369 - 377.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Yan, M. I. Mayranpaa, J. Wong, J. Perttila, M. Lehto, M. Jauhiainen, P. T. Kovanen, C. Ehnholm, A. J. Brown, and V. M. Olkkonen
OSBP-related Protein 8 (ORP8) Suppresses ABCA1 Expression and Cholesterol Efflux from Macrophages
J. Biol. Chem., January 4, 2008; 283(1): 332 - 340.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. Frikke-Schmidt, B. G. Nordestgaard, G. B. Jensen, R. Steffensen, and A. Tybjaerg-Hansen
Genetic Variation in ABCA1 Predicts Ischemic Heart Disease in the General Population
Arterioscler Thromb Vasc Biol, January 1, 2008; 28(1): 180 - 186.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
H. Cardinal, M.-A. Raymond, M.-J. Hebert, and F. Madore
Uraemic plasma decreases the expression of ABCA1, ABCG1 and cell-cycle genes in human coronary arterial endothelial cells
Nephrol. Dial. Transplant., February 1, 2007; 22(2): 409 - 416.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
C. Cavelier, L. Rohrer, and A. von Eckardstein
ATP-Binding Cassette Transporter A1 Modulates Apolipoprotein A-I Transcytosis Through Aortic Endothelial Cells
Circ. Res., November 10, 2006; 99(10): 1060 - 1066.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
E. Ikonen
Mechanisms for cellular cholesterol transport: defects and human disease.
Physiol Rev, October 1, 2006; 86(4): 1237 - 1261.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
j.jacc.2005.06.066v1
46/8/1516    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Frikke-Schmidt, R.
Right arrow Articles by Tybjærg-Hansen, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Frikke-Schmidt, R.
Right arrow Articles by Tybjærg-Hansen, A.

 
  CME Topic Collections Past Issues Search Current Issue Home

Advertisement