Advertisement






Click here for more guidelines.
CME Topic Collections Past Issues Search Current Issue Home
     

J Am Coll Cardiol, 2005; 46:827-834, doi:10.1016/j.jacc.2005.06.007 (Published online 24 August 2005).
© 2005 by the American College of Cardiology Foundation
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
j.jacc.2005.06.007v1
46/5/827    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (34)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sasso, F. C.
Right arrow Articles by Salvatore, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sasso, F. C.
Right arrow Articles by Salvatore, T.

CLINICAL RESEARCH: DIABETES AND CARDIOVASCULAR DISEASE

Increased Vascular Endothelial Growth Factor Expression But Impaired Vascular Endothelial Growth Factor Receptor Signaling in the Myocardium of Type 2 Diabetic Patients With Chronic Coronary Heart Disease

Ferdinando Carlo Sasso, MD, PhD*,{ddagger},*, Daniele Torella, MD{ddagger},§, Ornella Carbonara, MD*,{ddagger}, Georgina M. Ellison, PhD||, Michele Torella, MD{dagger},{ddagger}, Michelangelo Scardone, MD{dagger},{ddagger}, Claudio Marra, MD{dagger},{ddagger}, Rodolfo Nasti, MD*,{ddagger}, Raffaele Marfella, MD, PhD*,{ddagger}, Domenico Cozzolino, MD*,{ddagger}, Ciro Indolfi, MD{ddagger},§, Maurizio Cotrufo, MD{dagger},{ddagger}, Roberto Torella, MD*,{ddagger} and Teresa Salvatore, MD*,{ddagger}

* Department of Geriatrics and Metabolic Disease, Second University of Naples, Naples, Italy
{dagger} Department of Cardio-Thoracic and Respiratory Sciences, Second University of Naples, Naples, Italy
{ddagger} Excellence Centre for Cardiovascular Disease, Second University of Naples, Naples, Italy
§ Division of Cardiology, Magna Graecia University, Catanzaro, Italy
|| The Research Institute for Sport & Exercise Sciences, Liverpool John Moores University, Liverpool, United Kingdom

Manuscript received December 9, 2004; revised manuscript received January 15, 2005, accepted March 31, 2005.

* Reprint requests and correspondence: Dr. Ferdinando Carlo Sasso, Department of Geriatrics and Metabolic Disease, Institute of Internal Medicine, Second University of Naples, Via F. Petrarca, 64, 80122 Naples, Italy (Email: ferdinando.sasso{at}unina2.it).


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
OBJECTIVES: The aim of the present study was to evaluate the expression and the activity of vascular endothelial growth factor (VEGF) in the hearts of diabetic patients with chronic coronary heart disease (CHD).

BACKGROUND: Diabetes is characterized by a decreased collateral vessel formation in response to coronary ischemic events, although the role of VEGF in human diabetic macroangiopathy has not been fully investigated.

METHODS: Biopsies of left ventricular (LV) myocardium were obtained from 10 patients with type 2 diabetes and 10 non-diabetic patients with chronic CHD, all undergoing surgical coronary revascularization. Right ventricle myocardial samples taken from normal hearts were used as control specimens. Vascular endothelial growth factor and VEGF-receptors (flt-1 and flk-1) were evaluated by Western blot, reverse transcriptase-polymerase chain reaction (RT-PCR) and real-time RT-PCR. Akt and endothelial nitric oxide synthase (eNOS) protein expression and their phosphorylated forms were also evaluated by Western blot.

RESULTS: Vascular endothelial growth factor, flt-1, and flk-1 messenger ribonucleic acid (mRNA) and protein expressions were increased in non-diabetic patients with CHD compared with control subjects. Remarkably, in diabetic patients, VEGF mRNA and protein levels were significantly higher, whereas flt-1, flk-1 mRNA, and protein were lower when compared with non-diabetic patients. Interestingly, phospho-flk-1 was reduced in diabetic patients compared with non-diabetic patients. As a consequence, Akt phosphorylation, eNOS protein and its phosphorylated form were significantly higher in the samples from non-diabetic patients compared with diabetic patients.

CONCLUSIONS: Chronic CHD in diabetic patients is characterized by an increased VEGF myocardial expression and a decreased expression of its receptors along with a down-regulation of its signal transduction. The latter could be partially responsible for the reduced neoangiogenesis in diabetic patients with ischemic cardiomyopathy.

Abbreviations and Acronyms
  CHD = coronary heart disease
  CVD = cardiovascular disease
  EC = endothelial cell
  eNOS = endothelial nitric oxide synthase
  flt-1/VEGF-R1 = fms-like tyrosine kinase 1/VEGF-receptor 1
  flk-1/VEGF-R2 = fetal liver kinase 1/VEGF-receptor 2
  LV = left ventricle/ventricular
  MI = myocardial infarction
  mRNA = messenger ribonucleic acid
  OD = optical density
  PI3K = phosphatidylinositol-3 kinase
  RT-PCR = reverse transcriptase-polymerase chain reaction
  RV = right ventricle/ventricular
  Ser-1177 = phospho-eNOS
  VEGF = vascular endothelial growth factor


A large body of epidemiological and pathological data demonstrate that diabetes is an independent risk factor for cardiovascular disease (CVD) in both men and women (1). Accordingly, CVDs account for 65% of the deaths in people with diabetes (1). Furthermore, when patients with diabetes develop clinical CVD, they sustain a worse prognosis for survival than CVD patients without diabetes (1). Besides the well-recognized microvascular complications of diabetes, such as nephropathy and retinopathy, there is a growing epidemic of macrovascular complications, namely coronary heart disease (CHD). In particular, diabetes increases the incidence and accelerates the clinical course of CHD, mainly in the burgeoning type 2 diabetic population (2).

When large vessels are affected by atherosclerosis, the development of collateral vessels can be viewed as an attempt to minimize the degree of ischemic damage. Vascular endothelial growth factor (VEGF) is a major mediator of neovascularization in physiological and pathophysiological conditions with crucial roles in developmental blood vessel formation and regulation of hypoxia-induced tissue angiogenesis (3).

It has been shown that VEGF is a highly specific growth factor for endothelial cells (ECs) both in vitro and in vivo (4,5). Two high-affinity VEGF tyrosine kinase receptors have been identified: fms-like tyrosine kinase 1 (flt-1), also known as VEGF-R1, and fetal liver kinase 1 (flk-1), or VEGF-R2. Both receptors are expressed almost exclusively in ECs (6). Phosphatidylinositol-3 kinase (PI3K)-Akt-endothelial nitric oxide synthase (eNOS) signaling axis is the intracellular transduction pathway that mediates the pro-angiogenic effects of VEGF in ECs (7), and therefore, it plays a major role in the neovascularization in ischemic tissues (7–9).

The role of VEGF in diabetic microangiopathy has been well investigated. In particular, VEGF is up-regulated in diabetic retinopathy, causing pathological neovascularization (10). In contrast, the cardiac expression and activity of VEGF in diabetic macroangiopathy is basically unknown.

Vascular endothelial growth factor expression greatly increases after myocardial infarction (MI) in the hearts of non-diabetic patients (11) and contributes to the development of collateral vessels in the advanced stages of coronary atherosclerosis (12). Diabetic patients, however, exhibit inadequate collateral vascular formation in response to ischemia, which increases cardiovascular morbidity and mortality rates (12). Structural and functional abnormalities of the coronary collateral circulation have been reported in clinical and experimental diabetes mellitus (12,13).

A recent study showed that the expression of messenger ribonucleic acid (mRNA) and protein for VEGF and its receptors, flt-1 and flk-1, in the myocardium was significantly decreased in non-ischemic short-term (four weeks) experimental diabetic rats (14). In the same report, preliminary findings demonstrated two-fold reductions in VEGF and flk-1 in autoptic ventricular specimens from diabetic patients compared with non-diabetic patients who had died acutely from MI (14). In contrast, we recently observed an increased VEGF mRNA expression in the hearts of long-term (three months) experimental diabetic rats (15), although, in the same study, the mRNA transcript of flt-1 and flk-1 receptors was unaffected by the diabetic state (15).

Currently, the specific role of VEGF in the pathogenesis of decreased coronary collateral formation in diabetic patients with chronic CHD is not well defined. Therefore, in the present study, we investigated VEGF expression in chronic ischemic hearts from type 2 diabetic patients. Accordingly, we assessed the expression of the VEGF receptors and the activation of the VEGF-dependent pro-angiogenic intracellular signaling.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Patients.   The patients’ characteristics are described in Table 1. Briefly, the study comprised 10 type 2 diabetic men (age 61.4 ± 7.2 years) and 10 non-diabetic men (age 64.9 ± 10.5 years) presenting with previous MI and undergoing coronary bypass surgery for two-vessel (n = 2) or three-vessel (n = 18) disease. In the two patients with two-vessel disease, the left anterior descending coronary artery was involved. None of the enrolled subjects had clinical, electrocardiographic, or biochemical evidence of acute myocardial ischemia in the last six months. All enrolled patients were receiving similar medical therapy (nitrates, aspirin, low molecular weight heparin, angiotensin-converting enzyme inhibitors or angiotensin II type-1 receptor antagonists, 3-hydroxy-3-methylgluatryl coenzyme A [HMG-CoA] reductase inhibitors). Before surgery all diabetic patients showed good glycemic control, evident by a hemoglobin-A1c (HbA1c) level of <7%, stabilized with diet and use of oral hypoglycemic agents.


View this table:
[in this window]
[in a new window]
 
Table 1. Main Characteristics of the Patients Included in the Study
 
Non-diabetic status was defined in the presence of normal glucose tolerance during a standard oral load glucose test, performed before coronary surgery and interpreted according to American Diabetes Association criteria.

The control specimens were obtained from the myocardium of the right ventricle (RV) of seven pre-transplantation normal donor hearts, immediately after organ excision. These hearts were from patients (age 44 ± 11 years) who had died from non-cardiac disease. They were not diabetic and were not receiving any relevant medication that could have affected their use as control specimens.

The study protocol was approved by our institutional ethics committees for human subjects. Written informed consent was obtained from all patients.

Myocardial sampling.   In order to make our sampling more representative of the entire heart, left ventricular (LV) myocardial biopsies were obtained from two different cardiac sites—one taken close to the infarction, the other, distal from the infarct zone. This was performed with a single semiautomatic cutter biopsy needle (size 16G; MDL, Capriano Del Colle, Italy), before cardioplegic solution infusion. The same device was used to obtain control samples from the RV of the normal hearts. Myocardial biopsies were immediately frozen in liquid nitrogen.

Immunoblots.   For immunoblotting, 28 biopsies (n = 12 from six diabetic patients, n = 12 from six non-diabetic patients, n = 4 from control subjects) were homogenized, and proteins extracted as previously described (16). After polyacrilamide gel electrophoresis (PAGE), proteins were transferred and exposed to mouse monoclonal VEGF (Santa Cruz Biotechnology, Santa Cruz, California), mouse monoclonal anti-flt-1 (VEGF-R1) (Chemicon, Temecula, California), mouse monoclonal anti-flk-1 (VEGF-R2) (Chemicon), rabbit polyclonal phospho-Akt (Ser473) (Cell Signaling Technology, Beverly, Massachusetts), rabbit polyclonal Akt (Cell Signaling Technology), rabbit polyclonal eNOS (Santa Cruz Biotechnology), and rabbit polyclonal phospho-eNOS (Ser-1177) (Cell Signaling Technology) antibodies. Blots were incubated with the primary antibody, at a concentration suggested by manufacturers, overnight at 4°C in Tris-buffered saline with Tween (TBS-T), 5% non-fat dried milk. After extensive washing in TBS-T, blots were incubated with the secondary antibody (horseradish peroxidase-conjugated anti-mouse or anti-rabbit immunoglobulins; Santa Cruz Biotechnology) at a dilution of 1:1,000 for 45 min at room temperature. Specific proteins were detected by enhanced chemiluminescence (Amersham, Piscataway, New Jersey) and evaluated by densitometry. The monoclonal antibody used for the detection of eNOS specifically recognizes eNOS and does not cross-react with the inducible or neuronal NOS isoforms. Actin was used as internal control to correct for loading condition (anti-actin rabbit polyclonal antibody; Sigma, St. Louis, Missouri).

Immunoprecipitation and immunoblotting for phospho-flk-1.   Aliquots of protein lysates were obtained as described previously (16). Protein extracts were incubated overnight at 4°C with 3 µg of mouse polyclonal anti-flk-1 (Santa Cruz Biotechnology). Subsequently, 50 µl of protein A-agarose was added. Immunoprecipitated proteins were separated on 8% sodium-dodecyl-(lauryl)-sulfate-PAGE, transferred onto nitrocellulose filters, and exposed to rabbit polyclonal anti-phospho-flk-1 (Chemicon) (16).

Reverse transcriptase-polymerase chain (RT-PCR) reaction analysis.   Total RNA was extracted from 11 biopsies (n = 4 from diabetic patients, n = 4 from non-diabetic patients, n = 3 from control specimens) with Trizol Reagent (Invitrogen, Carlsbad, California). The RNA was converted to complementary DNA (cDNA) by reverse transcription with random hexanucleotides (Promega, Madison, Wisconsin). The VEGF transcripts were amplified with human VEGF primer pair (R&D Systems, Minneapolis, Minnesota), according to the manufacturer’s instructions. Specific primers for VEGF-R1 (flt-1) were CAAGTGGCCAGAGGCATGGAGTT and TAGTCTTTACCATCCTGTTG, and for VEGF-R2 (flk-1), GAGGGCCACTCATGGTGATTG and GCAGTCCAGCATGGTCTG.

Quantitative real-time RT-PCR analysis.   Real-time RT-PCR was performed with the Taqman detection protocol in an ABI Prism 7700 thermocycler (Applied Biosystems, Foster City, California). The results for VEGF real-time RT-PCR assays were normalized to those obtained for the corresponding B-actin mRNA, providing a relative quantitation value (17). The B-actin mRNA showed relatively small variation under the conditions tested. Primers were designed with the Primer Express program (Applied Biosystems), and the following sequences were used: human VEGF, forward 5'-GCACCCATG GCAGAAGGA, reverse 5'-GCTGCGCTGATAGACATCCA; VEGF-R1, forward primer 5'-GCATATGGTATCCCTCAACCTACAA-3', reversed primer 5'-CATCCAGGATAAAGGACTCTTCATTAT-3'; VEGF-R2, forward 5'-CTTCTGGCTACTTCTTGTCATCAT-3', primer 5'-CCTACGCTTTGGGTTTTCCA-3'; and human B-actin, forward 5'-ATCAAGATCATTGCTCCTCCT GAG, reverse 5'-AGCGAGGCCAGGATGGA. A standard curve of cDNA was tested in each real-time RT-PCR experiment to confirm the dynamic range for quantitation. The specificity of the amplification reaction was determined by performing a melting curve analysis.

Data analysis.   Autoradiograms were analyzed by an image analyzer (Gel Doc 1000, Bio-Rad, Hercules, California). All data are shown as mean ± SD. Statistical analysis among the three groups was performed by analysis of variance (ANOVA) with an SPSS statistical program (version 10.0, SPSS Inc., Chicago, Illinois). When a significant overall effect was detected, the Bonferroni test was applied to compare single mean values. A p value <0.05 was considered significant.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
VEGF and VEGF-Rs expression.   The VEGF and VEGF-Rs mRNA and protein expression in the biopsy samples obtained from the LV of non-diabetic and diabetic patients with chronic CHD were analyzed. Tissue samples from the RV of normal hearts were used as control specimens. The optical density (OD, arbitrary units) of VEGF protein expression in diabetic, non-diabetic, and control hearts was, respectively, 3.0 ± 0.4, 0.5 ± 0.15, and 0.14 ± 0.09 (Fig. 1). The ANOVA showed a statistically significant difference (p < 0.01, overall effect) among the three groups, and Bonferroni correction confirmed the difference (p < 0.01 for all pairwise comparisons). Specifically, in the samples from the diabetic patients with CHD, OD of VEGF protein levels were 21- and 6-fold higher than that of control specimens and non-diabetic patients with CHD, respectively (Fig. 1).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 1 (A) Representative Western blot showing vascular endothelial growth factor (VEGF) and VEGF receptors fms-like tyrosine kinase 1 (flt-1) and fetal liver kinase 1 (flk-1) protein expression in the myocardial samples from control human hearts, non-diabetic and diabetic patients with coronary heart disease (CHD). 1 to 3 = control specimens; 4 to 6 = non-diabetic patients with chronic CHD; 7 to 9 = diabetic patients with chronic CHD. (B) Optical density (O.D.) of VEGF, flt-1, and flk-1. *Statistical difference from control specimens; **statistical difference from non-diabetic patients.

 
The flt-1 and flk-1 protein expression was statistically higher (p < 0.01) in the biopsies obtained from non-diabetic patients (OD 1.1 ± 0.2 and 3.1 ± 0.9, respectively) when compared with control specimens (0.2 ± 0.1 and 0.4 ± 0.2, respectively) and diabetic patients (0.3 ± 0.15 and 0.8 ± 0.3, respectively). Notably, no statistically significant difference (p > 0.05) was found between diabetic and control specimens for flt-1 and flk-1 protein expression (Fig. 1).

The increased VEGF protein levels corresponded to an increased VEGF mRNA expression in the samples from diabetic patients compared with control specimens and non-diabetic patients, when analyzed by RT-PCR (Fig. 2). In parallel with the results of protein expression, flt-1 and flk-1 receptor mRNA in the myocardial biopsies from non-diabetic patients was higher than that of control specimens (Fig. 2). Likewise, flt-1 and flk-1 receptor mRNA did not differ between control specimens and diabetic patients (Fig. 2).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 2 (A) Representative reverse transcriptase-polymerase chain reaction (RT-PCR) showing VEGF165 and VEGF receptors (flt-1 and flk-1) messenger ribonucleic acid (mRNA) levels in the myocardial samples from control human hearts, non-diabetic and diabetic patients with CHD. 1 to 3 = control specimens; 4 to 6 = non-diabetic patients with chronic CHD; 7 to 9 = diabetic patients with chronic CHD. (B) Real-time RT-PCR quantification of myocardial VEGF, flt-1 and flk-1 mRNA. Data are the ratio values of VEGF/B-Actin, Flt-1/B-Actin, and Flk-1/B-Actin mRNA (arbitrary units). *Statistical difference from control specimens; **statistical difference from non-diabetic patients. bp = base pair; other abbreviations as in Figure 1.

 
To obtain quantitative data on VEGF and VEGF-Rs gene expression, the RNA extracted from the biopsies of the three groups was also used for real-time RT-PCR. The real-time RT-PCR results for VEGF were normalized to those obtained for the corresponding B-actin mRNA. Specifically, real-time PCR showed that VEGF/B-actin ratio in myocardial biopsies from diabetic, non-diabetic, and control patients was 220 ± 29, 150 ± 32, and 92 ± 22, respectively (Fig. 2). The VEGF mRNA expression was statistically different among the three groups (p < 0.01, overall effect and for all pairwise comparisons). Furthermore, flt-1/B-actin and flk-1/B-actin ratios were 510 ± 70 and 390 ± 55, respectively, in the biopsies from non-diabetic patients. This value was higher than control specimens (flt-1/B-actin = 350 ± 53; flk-1/B-actin = 260 ± 70; p < 0.01) and diabetic patients (flt-1/B-actin = 320 ± 65; flk-1/B-actin = 245 ± 65; p < 0.01). No significant (p > 0.05) difference was found between control specimens and diabetic patients.

Of note, there were no differences in VEGF and VEGF-Rs protein expression between the two myocardial biopsy sites taken from the same heart, in both the diabetic and non-diabetic patients. Therefore, these findings would suggest that our sampling was representative of the entire LV myocardium. On this basis, the data for protein expression obtained from both biopsies was pooled.

VEGF receptors signal transduction.   The finding of an increased VEGF expression without a corresponding increase in VEGF-R levels in the samples from diabetic patients prompted us to assess the transduction of VEGF intracellular signaling. Recent studies have documented the key role of PI3K/Akt pathway in modulating the angiogenic effects induced by VEGF through flk-1 receptor (18). Furthermore, VEGF has been shown to up-regulate eNOS mRNA and protein levels, and the PI3K/Akt pathway directly activates eNOS by phosphorylation at Ser-1177, rendering the enzyme activity calcium-independent (19). Indeed, Akt-dependent phosphorylation of eNOS mediates the effects of VEGF on ECs (20). Therefore, we investigated the expression and phosphorylation of Akt and eNOS proteins in the myocardial biopsies from the three groups included in the present study.

Remarkably, we found that VEGF-R2 phosphorylation was statistically different among the three groups (non-diabetic, diabetic, and control OD: 0.9 ± 0.2, 0.1 ± 0.05, 0.01 ± 0.01, respectively; p < 0.01, overall effect) and significantly higher in non-diabetic versus diabetic patients (p < 0.01, Bonferroni correction) and versus control specimens (p < 0.01, Bonferroni correction) as well as in diabetic versus control specimens (p < 0.01, Bonferroni correction) (Fig. 3).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 3 (A) Representative Western blot showing phospho-flk-1 and Akt and endothelial nitric oxide synthase (eNOS) protein expression and their phosphorylation forms in the myocardial samples from the three groups included in the study. 1 to 3 = control specimens; 4 to 6 = non-diabetic patients with chronic CHD; 7 to 9 = diabetic patients with chronic CHD. (B) Optical density (O.D.) of phospho-flk-1, phospho-Akt, total and phospho-eNOS, and phospho-eNOS/total eNOS ratio. *Statistical difference from control specimens; **statistical difference from non-diabetic patients. Other abbreviations as in Figure 1.

 
The biopsies from the three groups all exhibited similar Akt total protein expression (Fig. 3). In contrast, Akt phosphorylation was statistically different among the three groups (non-diabetic, diabetic, and control specimen OD: 1.0 ± 0.1, 0.2 ± 0.05, and 0.05 ± 0.03, respectively, p < 0.01, overall effect) and significantly higher in non-diabetic versus diabetic patients (p < 0.01, Bonferroni correction) and versus control specimens (p < 0.01, Bonferroni correction) as well as in diabetic patients versus control specimens (p < 0.01, Bonferroni correction) (Fig. 3).

The eNOS protein levels were comparable between control specimens (OD 2.9 ± 0.9) and non-diabetic patients (OD 3.2 ± 0.8) (Fig. 3). In contrast, eNOS protein expression was significantly (p <0.01) reduced in the LV biopsies from diabetic patients (OD 1.3 ± 0.4) compared with control specimens and non-diabetic patients (Fig. 3). The elevated Akt phosphorylation in non-diabetic patients was associated with a substantial eNOS phosphorylation (OD 1.2 ± 0.1), which was significantly higher when compared with control specimens (OD 0.07 ± 0.03; p < 0.01) and diabetic patients (OD 0.05 ± 0.04; p < 0.01) (Fig. 3). Specifically, no significant differences were observed between diabetic patients and control specimens for eNOS phosphorylation (Fig. 3). The phospho-eNOS/eNOS ratio revealed an actual decrease in activated eNOS in diabetic patients compared with non-diabetic patients (Fig. 3).


    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
The present findings provide the first analysis of VEGF and VEGF-Rs in myocardial tissue obtained from diabetic patients with chronic CHD. More specifically, the VEGF intracellular signal transduction was also identified, providing a possible novel mechanistic explanation for the reduced coronary collateral formation in ischemic diabetic hearts. We have made three original observations in these patients when compared with non-diabetic subjects: 1) increased VEGF myocardial expression, 2) no concomitant increase in the expression of flk-1 and flt-1 receptors, and 3) down-regulation of VEGF-dependent intracellular signaling, as shown by reduced flk-1 phosphorylation and consequent reduced Akt phosphorylation and decreased eNOS protein expression and phosphorylation.

Much of the morbidity and mortality associated with diabetes is primarily attributable to the consequences of microvascular and macrovascular disease (21). Over the past years, many of the underlying etiologies for the microvascular and macrovascular complications associated with diabetes have been identified. Interestingly, in some microvascular tissues, increased growth factor expression (namely VEGF), secondary to hyperglycemia, advanced glycation end products, oxidative stress and ischemia, results in pathologic neovascularization, and increased vascular permeability (21). This angiogenic response, however, seems to be reduced in patients with diabetes-associated macrovascular disease (i.e., coronary artery disease and peripheral limb ischemia) (12).

Why the myocardium is different in its response to ischemia in this patient population is still a matter of strong debate. One intriguing, but not yet proven, possibility could be related to the unique aspects of coronary vessel development, not observed in the formation of other blood vessels (22).

After cardiac ischemic events, coronary collateral blood vessel formation helps in preserving myocardial function and viability by reducing myocardial ischemia and functional deficit (23). Vascular endothelial growth factor seems to play a significant role in this adaptive response. Normal mammalian heart expresses VEGF and its receptors. Importantly, after MI, cardiac VEGF expression increases in the human and rodent hearts (24). In this regard, VEGF gene transfer is still an important therapeutic option to induce vascular growth after critical ischemia (25,26).

It has been reported that VEGF mRNA, its protein, and VEGF receptors are all significantly decreased in myocardia from short-term experimental diabetic rats and in diabetic patients who died from acute MI (14). We have reported findings, however, of increased VEGF mRNA transcripts in the hearts of long-term (three months) experimental diabetic rats (15), but the mRNA expression of flt-1 and flk-1 receptors was unaffected (15). It could be that VEGF is reduced in the short term but increased in the long term, owing to a compensatory reaction from desensitization and/or down-regulation of the VEGF receptors in the diabetic state. Furthermore, previous compelling data showed that diabetes impairs the development of new collateral vessel formation in response to acute hind limb ischemia, as the result of a lower level of VEGF acutely after the ischemic event (27). Accordingly, we recently showed a decreased expression of hypoxia-inducible factor-1-alpha and VEGF in ischemic human myocardial specimens from diabetic patients with acute coronary syndromes (28). Consistent with our hypothesis of short- and long-term differential regulation of VEGF expression in diabetes, here we observed an increased myocardial protein and mRNA VEGF expression in diabetic patients with chronic CHD, but decreased VEGF receptor expression.

It is established that the diabetic state is characterized by a higher severity of myocardial ischemia in patients with CHD (13). Therefore, the prolonged and stringent hypoxic stress in these patients could be the cause of the increased myocardial VEGF expression. Increased renin-angiotensin system activation is a known stimulus for VEGF expression and a main feature of the diabetic heart (29,30). Thus, it could be speculated that the increased VEGF expression in the LV biopsies from diabetic patients with chronic CHD could be partially related to up-regulation of the myocardial renin-angiotensin system.

Importantly, in spite of the presence of an increased VEGF expression, we did not observe a parallel increase in the expression of flt-1 and flk-1 receptors in the myocardial samples from diabetic hearts. Indeed, VEGF receptors were decreased in diabetic compared with non-diabetic patients with CHD. Furthermore, the activation of flk-1, which mainly transmits the VEGF-dependent angiogenic signal (31), was severely impaired in the biopsies from diabetic compared with non-diabetic patients. As a consequence, we observed a down-regulation of VEGF-dependent signal transduction, as shown by decreased Akt phosphorylation and decreased eNOS protein expression and phosphorylation This down-regulation and desensitization of the VEGF receptors in the long term could further exacerbate the ischemic state, impairing neovascularization, but causing a greater production of VEGF to compensate for the resistance of the receptors.

The PI3K/Akt signaling pathway is crucial in mediating EC proliferation, migration, and survival (7,19,20,32,33). The PI3K/Akt signaling axis regulates angiogenesis as well as vascular homeostasis through eNOS activation (8,9). Accordingly, eNOS modulates angiogenesis in response to tissue ischemia (8,33).

Thus, impaired Akt activation and reduced eNOS expression and activation could be the result of desensitization and/or down-regulation of the VEGF-Rs in diabetic ischemic hearts.

Study limitations.   It should not be forgotten that myocytes synthesize VEGF (34) and VEGF receptors have been found in small quantities in rat neonatal myocytes (35). Therefore, it is possible that the discrepancy between VEGF amount and the receptor amount and function in diabetic patients with CHD could be partially attributed to VEGF modulation from the myocytes. Furthermore, we cannot exclude that the reduced VEGF-Rs expression in diabetes observed in the present study is not related to an actual lower density of the receptors, but rather, reflects a decreased number of capillaries; it is likely that these events co-exist. Moreover, it should also be pointed out that a specific analysis of collaterals in the patients included in our study was not carried out and the angiographies were not conclusive on this point. Additionally, the small number of patients used here could be misleading in such an issue.

In the present study we used RV specimens as our control group. To our best knowledge, no studies have specifically addressed the difference in the expression of VEGF in the right and left ventricles of the adult human heart, although it is important to note that different studies have shown that VEGF is expressed homogenously in the adult animal heart (36,37).

Our data suggest that there is a deregulation in the feedback loop between VEGF synthesis and receptor signaling in the diabetic state. The reason for this receptor malfunction could be due to hyperglycemia and/or be the consequence of a general receptor signal insensitivity related to the insulin resistance syndrome. This issue cannot be addressed in the present study but warrants further investigation.

Conclusions.   In the present study, we found, for the first time, an increased myocardial mRNA and protein expression of VEGF in diabetic patients with chronic CHD. Concurrently, we observed decreased mRNA and protein expression of VEGF receptors, flt-1 and flk-1, when compared with non-diabetic ischemic patients. As a result, VEGF-dependent pro-angiogenic signal transduction was impaired, evidenced by decreased Akt and eNOS activation. This could potentially represent a novel molecular, mechanistic explanation for the severe impairment in collateral vessel formation in diabetic patients with CHD.

From a strictly clinical point of view, our data suggest that therapeutic angiogenesis by growth factor administration alone might not be helpful in restoring endothelial function and stimulating collateral neoangiogenesis in diabetic patients with chronic CHD. Further investigations to clarify the validity of these speculations are warranted.


    Footnotes
 
Drs. Sasso and Torella contributed equally to this study.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
1. Grundy SM, Benjamin IJ, Burke GL, et al. Diabetes and cardiovascular diseasea statement for healthcare professionals from the American Heart Association. Circulation 1999;100:1134-1146.[Free Full Text]

2. Beckman JA, Creager MA, Libby P. Diabetes and atherosclerosis. Epidemiology, pathophysiology, and management JAMA 2002;287:2570-2581.[Abstract/Free Full Text]

3. Ferrara N, Davis-Smyth T. The biology of vascular endothelial growth factor Endocr Rev 1997;18:4-25.[Abstract/Free Full Text]

4. Leung DW, Cachianes G, Kuang WJ, Goeddel DV, Ferrara N. Vascular endothelial growth factor is a secreted angiogenic mitogen Science 1989;246:1306-1309.[Abstract/Free Full Text]

5. Banai S, Shweiki D, Pinson A, Chandra M, Lazarovici G, Keshet E. Upregulation of vascular endothelial growth factor expression induced by myocardial ischemiaimplications for coronary angiogenesis. Cardiovasc Res 1994;28:1176-1179.[Abstract/Free Full Text]

6. Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z. Vascular endothelial growth factor and its receptors FASEB J 1999;13:9-22.[Abstract/Free Full Text]

7. Shiojima I, Walsh K. Role of Akt signaling in vascular homeostasis and angiogenesis Circ Res 2002;90:1243-1250.[Abstract/Free Full Text]

8. Murohara T, Asahara T, Silver M, et al. Nitric oxide synthase modulates angiogenesis in response to tissue ischemia J Clin Invest 1998;101:2567-2578.[Web of Science][Medline]

9. Matsunaga T, Warltier DC, Weihrauch DW, Moniz M, Tessmer J, Chilian WM. Ischemia-induced coronary collateral growth is dependent on vascular endothelial growth factor and nitric oxide Circulation 2000;102:3098-3103.[Abstract/Free Full Text]

10. Frank RN. Diabetic retinopathy N Engl J Med 2004;350:48-58.[Free Full Text]

11. Shinohara K, Shinohara T, Mochizuki N, et al. Expression of vascular endothelial growth factor in human myocardial infarction Heart Vessels 1996;11:113-122.[CrossRef][Web of Science][Medline]

12. Abaci A, Oguzhan A, Kahraman S, et al. Effect of diabetes mellitus on formation of coronary collateral vessel Circulation 1999;99:2239-2242.[Abstract/Free Full Text]

13. Aronson D, Rayfield EJ, Chesebro JH. Mechanisms determining course and outcome of diabetic patients who have had acute myocardial infarction Ann Intern Med 1997;126:296-306.[Abstract/Free Full Text]

14. Chou E, Suzuma I, Way KJ, et al. Decreased cardiac expression of vascular endothelial growth factor and its receptors in insulin-resistant and diabetic statesa possible explanation for impaired collateral formation in cardiac tissue. Circulation 2002;105:373-379.[Abstract/Free Full Text]

15. Sasso FC, Carbonara O, Persico E, et al. Increased vascular endothelial growth factor mRNA expression in the heart of streptozotocin-induced diabetic rats Metabolism 2003;52:675-678.[CrossRef][Web of Science][Medline]

16. Torella D, Rota M, Nurzynska D, et al. Cardiac stem cell and myocyte aging, heart failure, and insulin-like growth factor-1 overexpression Circ Res 2004;94:514-524.[Abstract/Free Full Text]

17. Abraham D, Hofbauer R, Schafer R, et al. Selective downregulation of VEGF-A(165), VEGF-R(1), and decreased capillary density in patients with dilative but not ischemic cardiomyopathy Circ Res 2000;87:644-647.[Abstract/Free Full Text]

18. Dimmeler S, Fleming I, Fisslthaler B, Hermann C, Busse R, Zeiher AM. Activation of nitric oxide synthase in endothelial cells by Akt-dependent phosphorylation Nature 1999;399:601-605.[CrossRef][Medline]

19. Dimmeler S, Dernbach E, Zeiher AM. Phosphorylation of the endothelial nitric oxide synthase at Ser-1177 is required for VEGF-induced endothelial cell migration FEBS Lett 2000;477:258-262.[CrossRef][Web of Science][Medline]

20. Fujio Y, Walsh K. Akt mediates cytoprotection of endothelial cells by vascular endothelial growth factor in an anchorage-dependent manner J Biol Chem 1999;274:16349-16354.[Abstract/Free Full Text]

21. Duh E, Aiello LP. Vascular endothelial growth factor and diabetes. The agonist versus antagonist paradox Diabetes 1999;48:1899-1906.[Abstract]

22. Wada AM, Willet SG, Bader D. Coronary vessel developmenta unique form of vasculogenesis. Arterioscler Thromb Vasc Biol 2003;23:2138-2145.[Abstract/Free Full Text]

23. Sabia PJ, Powers ER, Ragosta M, Sarembock IJ, Burwell LR, Kaul S. Association between collateral blood flow and myocardial viability in patients with recent myocardial infarction N Engl J Med 1992;327:1825-1831.[Abstract]

24. Li J, Brown LF, Hibberd MG, Grossman JD, Morgan JP, Simons M. VEGF, flk-1, and flt-1 expression in a rat myocardial infarction model of angiogenesis Am J Physiol 1996;270:H1803-H1811.

25. Losordo DW, Dimmeler S. Therapeutic angiogenesis and vasculogenesis for ischemic disease: part II: cell-based therapies Circulation 2004;109:2692-2697.[Free Full Text]

26. Losordo DW, Dimmeler S. Therapeutic angiogenesis and vasculogenesis for ischemic disease: part I: angiogenic cytokines Circulation 2004;109:2487-2491.[Free Full Text]

27. Rivard A, Silver M, Chen D, et al. Rescue of diabetes-related impairment of angiogenesis by intramuscular gene therapy with adeno-VEGF Am J Pathol 1999;154:355-363.[Abstract/Free Full Text]

28. Marfella R, Esposito K, Nappo F, et al. Expression of angiogenic factors during acute coronary syndromes in human type 2 diabetes Diabetes 2004;53:2383-2391.[Abstract/Free Full Text]

29. Zhang X, Lassila M, Cooper ME, Cao Z. Retinal expression of vascular endothelial growth factor is mediated by angiotensin type 1 and type 2 receptors Hypertension 2004;43:276-281.[Abstract/Free Full Text]

30. Frustaci A, Kajstura J, Chimenti C, et al. Myocardial cell death in human diabetes Circ Res 2000;87:1123-1132.[Abstract/Free Full Text]

31. Gerber HP, McMurtrey A, Kowalski J, et al. Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3'-kinase/Akt signal transduction pathway. Requirement for Flr/KDR activation J Biol Chem 1998;273:30336-30343.[Abstract/Free Full Text]

32. Kureishi Y, Luo Z, Shiojima I, et al. The HMG-CoA reductase inhibitor simvastatin activates the protein kinase Akt and promotes angiogenesis in normocholesterolemic animals Nat Med 2000;6:1004-1010.[CrossRef][Web of Science][Medline]

33. Papapetropoulos A, Garcia-Cardena G, Madri JA, Sessa WC. Nitric oxide production contributes to the angiogenic properties of vascular endothelial growth factor in human endothelial cells J Clin Invest 1997;100:3131-3139.[Web of Science][Medline]

34. Wu G, Mannam AP, Wu J, et al. Hypoxia induces myocyte-dependent COX-2 regulation in endothelial cellsrole of VEGF. Am J Physiol Heart Circ Physiol 2003;285:H2420-H2429.[Abstract/Free Full Text]

35. Takahashi N, Seko Y, Noiri E, et al. Vascular endothelial growth factor induces activation and subcellular translocation of focal adhesion kinase (p125FAK) in cultured rat cardiac myocytes Circ Res 1999;84:1194-1202.[Abstract/Free Full Text]

36. Li J, Hampton T, Morgan JP, Simons M. Stretch-induced VEGF expression in the heart J Clin Invest 1997;100:18-24.[Web of Science][Medline]

37. Partovian C, Adnot S, Eddahibi S, et al. Heart and lung VEGF mRNA expression in rats with monocrotaline- or hypoxia-induced pulmonary hypertension Am J Physiol 1998;275:H1948-H1956.




This article has been cited by other articles:


Home page
HypertensionHome page
F. Addabbo, M. Montagnani, and M. S. Goligorsky
Mitochondria and Reactive Oxygen Species
Hypertension, June 1, 2009; 53(6): 885 - 892.
[Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
N. Koleganova, G. Piecha, E. Ritz, and M.-L. Gross
Calcitriol ameliorates capillary deficit and fibrosis of the heart in subtotally nephrectomized rats
Nephrol. Dial. Transplant., March 1, 2009; 24(3): 778 - 787.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
R. Arita, Y. Hata, S. Nakao, T. Kita, M. Miura, S. Kawahara, S. Zandi, L. Almulki, F. Tayyari, H. Shimokawa, et al.
Rho Kinase Inhibition by Fasudil Ameliorates Diabetes-Induced Microvascular Damage
Diabetes, January 1, 2009; 58(1): 215 - 226.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J.-X. Chen and A. Stinnett
Disruption of Ang-1/Tie-2 Signaling Contributes to the Impaired Myocardial Vascular Maturation and Angiogenesis in Type II Diabetic Mice
Arterioscler Thromb Vasc Biol, September 1, 2008; 28(9): 1606 - 1613.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Hazarika, A. O. Dokun, Y. Li, A. S. Popel, C. D. Kontos, and B. H. Annex
Impaired Angiogenesis After Hindlimb Ischemia in Type 2 Diabetes Mellitus: Differential Regulation of Vascular Endothelial Growth Factor Receptor 1 and Soluble Vascular Endothelial Growth Factor Receptor 1
Circ. Res., October 26, 2007; 101(9): 948 - 956.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. Boodhwani, N. R. Sodha, S. Mieno, S.-H. Xu, J. Feng, B. Ramlawi, R. T. Clements, and F. W. Sellke
Functional, Cellular, and Molecular Characterization of the Angiogenic Response to Chronic Myocardial Ischemia in Diabetes
Circulation, September 11, 2007; 116(11_suppl): I-31 - I-37.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
B. Doyle and N. Caplice
Plaque Neovascularization and Antiangiogenic Therapy for Atherosclerosis
J. Am. Coll. Cardiol., May 29, 2007; 49(21): 2073 - 2080.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. Mannheim, D. Versari, E. Daghini, M. Gossl, O. Galili, A. Chade, V. S. Rajkumar, E. L. Ritman, L. O. Lerman, and A. Lerman
Impaired myocardial perfusion reserve in experimental hypercholesterolemia is independent of myocardial neovascularization
Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2449 - H2458.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. Jesmin, S. Zaedi, N. Shimojo, M. Iemitsu, K. Masuzawa, N. Yamaguchi, C. N. Mowa, S. Maeda, Y. Hattori, and T. Miyauchi
Endothelin antagonism normalizes VEGF signaling and cardiac function in STZ-induced diabetic rat hearts
Am J Physiol Endocrinol Metab, April 1, 2007; 292(4): E1030 - E1040.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
Y. Li, S. Hazarika, D. Xie, A. M. Pippen, C. D. Kontos, and B. H. Annex
In Mice With Type 2 Diabetes, a Vascular Endothelial Growth Factor (VEGF)-Activating Transcription Factor Modulates VEGF Signaling and Induces Therapeutic Angiogenesis After Hindlimb Ischemia
Diabetes, March 1, 2007; 56(3): 656 - 665.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
R. Kivela, M. Silvennoinen, A.-M. Touvra, T. M. Lehti, H. Kainulainen, and V. Vihko
Effects of experimental type 1 diabetes and exercise training on angiogenic gene expression and capillarization in skeletal muscle
FASEB J, July 1, 2006; 20(9): 1570 - 1572.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
A. N. DeMaria, O. Ben-Yehuda, D. Berman, G. K. Feld, G. S. Ginsburg, B. H. Greenberg, W. Y.W. Lew, D. Sahn, and S. Tsimikas
Highlights of the Year in JACC 2005
J. Am. Coll. Cardiol., January 3, 2006; 47(1): 184 - 202.
[Full Text] [PDF]


Home page
J Am Coll CardiolHome page
M. Simons
Angiogenesis, Arteriogenesis, and Diabetes: Paradigm Reassessed?
J. Am. Coll. Cardiol., September 6, 2005; 46(5): 835 - 837.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
j.jacc.2005.06.007v1
46/5/827    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (34)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sasso, F. C.
Right arrow Articles by Salvatore, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sasso, F. C.
Right arrow Articles by Salvatore, T.

 
  CME Topic Collections Past Issues Search Current Issue Home

Advertisement