|
| HOME | SUBSCRIPTIONS | CURRENT ISSUE | PAST ISSUES | CARDIOSOURCE | SEARCH | HELP | FEEDBACK |
|
|
|
|||||||||
|
|||||||||||
|
J Am Coll Cardiol, 2004; 43:1481-1488, doi:10.1016/j.jacc.2003.11.043 © 2004 by the American College of Cardiology Foundation |
* Cardiovascular Division, Department of Internal Medicine, Institute of Clinical Medicine, University of Tsukuba, Tsukuba, Ibaraki, Japan
Manuscript received August 28, 2003; revised manuscript received November 15, 2003, accepted November 18, 2003.
* Reprint requests and correspondence: Dr. Takashi Miyauchi, Cardiovascular Division, Department of Internal Medicine, Institute of Clinical Medicine, University of Tsukuba, Tsukuba, Ibaraki 305-8575, Japan.
t-miyauc{at}md.tsukuba.ac.jp
 |
Abstract |
|---|
 Top Abstract MethodsResultsDiscussionReferences |
|---|
BACKGROUND: Patients with hypertensive heart disease often have diastolic heart failure without systolic dysfunction. Meanwhile, it has been well established in atherosclerosis that PPAR-alpha activation negatively regulates early inflammation. In hypertensive hearts, however, it is still unclear whether PPAR-alpha activation inhibits inflammation and fibrosis.
METHODS: Twenty-one rats were randomly separated into the following three groups: deoxycorticosterone acetate (DOCA)-salt hypertensive rats treated with a PPAR-alpha activator, fenofibrate (80 mg/kg/day for 5 weeks); DOCA-salt rats treated with vehicle only; and uni-nephrectomized rats as normotensive controls.
RESULTS: Fenofibrate significantly inhibited the elevation of left ventricular end-diastolic pressure and the reduction of the magnitude of the negative maximum rate of left ventricular pressure rise and decline, corrected by left ventricular pressure (–dP/dtmax/P), which are indicators of diastolic dysfunction. Next, fenofibrate prevented myocardial fibrosis and reduced the hydroxyproline content and procollagen I and III messenger ribonucleic acid expression. Finally, inflammatory gene expression associated with NF-kappa-B (interleukin-6, cyclooxygenase-2, vascular cell adhesion molecule-1, and monocyte chemoattractant protein-1), which is upregulated in DOCA-salt rats, was significantly suppressed by fenofibrate. Activation of NF-kappa-B and expression of I-kappa-B-alpha in DOCA-salt rats were normalized by fenofibrate.
CONCLUSIONS: A PPAR-alpha activator reduced myocardial fibrosis and prevented the development of diastolic dysfunction in DOCA-salt rats. The effects of a PPAR-alpha activator may be mediated partly by prevention of inflammatory mediators through the NF-kappa-B pathway. These results suggest that treatment with PPAR-alpha activators will improve diastolic dysfunction in hypertensive heart disease.
| ||||||||||||||||||||||||||||||
Peroxisome proliferator-activated receptors (PPARs) belong to a superfamily of nuclear ligand-activated transcription factors. The PPARs are key players in lipid and glucose metabolism and are implicated in metabolic disorders predisposing to atherosclerosis (2). At present, three major PPAR family members have been identified: PPAR-alpha is highly expressed in the liver and to a lesser extent in the heart, skeletal muscle, and kidney; PPAR-gamma is predominately expressed in adipose tissue; and PPAR-delta is ubiquitously expressed. Whereas PPAR-gamma promotes lipid storage by regulating adipocyte differentiation, PPAR-alpha stimulates beta-oxidative degradation of fatty acids.
Mice deficient in PPAR-alpha a prolonged response to inflammatory stimuli and age-dependent myocardial fibrosis, suggesting that PPAR-alpha is also a modulator of inflammation and fibrosis (3,4). Hypolipidemic fibrate drugs are PPAR-alpha ligands that inhibit the progressive formation of atherosclerotic lesions, which involves chronic inflammatory processes (5), even in the absence of an atherogenic lipoprotein-lowering effect (6,7). Various data suggest that fibrates inhibit the vascular inflammatory response via PPAR-alpha by interfering with the nuclear factor (NF)-kappa-B transactivation capacity, involving a direct protein-protein interaction with the p65 subunit (8,9). Our preliminary study demonstrated that a PPAR-alpha activator prevented myocardial fibrosis in the heart of hypertrophied rats after abdominal aortic banding (10), but we did not clarify the mechanism by which a PPAR-alpha activator prevented myocardial fibrosis and whether it improved diastolic dysfunction of the heart in that model.
Therefore, the purpose of this study was to examine the effects of a PPAR-alpha activator, fenofibrate, on myocardial fibrosis and diastolic dysfunction in a deoxycorticosterone acetate (DOCA)-salt hypertensive rat model. The reason we used DOCA-salt rats for the present study is that rats with prolonged hypertension provided a more suitable model of human hypertensive heart disease. Furthermore, it is important to investigate the effects of fenofibrate with respect to the inflammatory response contributing to myocardial fibrosis, because Ammarguellat et al. (11) suggested that activation of inflammatory mediators related to NF-kappa-B could be major components of myocardial fibrosis in this model. Therefore, we examined the gene expression of inflammatory cytokines that are regulated by NF-kappa-B, such as interleukin-6 (IL-6), cyclooxygenase-2 (COX-2), vascular cell adhesion molecule-1 (VCAM-1), and monocyte chemoattractant protein-1 (MCP-1), at the messenger ribonucleic acid (mRNA) level in this model, as well as the effects of a PPAR-alpha activator on both NF-kappa-B activation and I-kappa-B-alpha protein expression.
|
Methods |
|---|
|
TopAbstractMethodsResultsDiscussionReferences |
|---|
Hemodynamic studies and tissue sampling. All rats were sacrificed five weeks after surgery. A 2.0F, high-fidelity, manometer-tipped catheter (SPR-402, Millar Instruments, Houston, Texas) was introduced through the right carotid artery into the LV under pentobarbital anesthesia (50 mg/kg, intraperitoneally). Tracings of LV pressure were digitized at a rate of 1,000 samples/s with a commercial analog-to-digital converter (MP100WS, BIOPAC Systems Inc., Goleta, California) and a personal computer using dedicated software (Acknowledge III, Version 3, BIOPAC Systems Inc., Goleta, California). Left ventricular end-diastolic pressure (LVEDP) was determined as the pressure just before the onset of an increase in LV systolic pressure (14,15). After measurement of LV pressure, the rats were sacrificed. According to quote papers (16–18), the heart was excised and the ventricles were divided into the LV, including the interventricular septum, and the right ventricle. The ventricular samples were rinsed with cold saline, weighed, quickly frozen in liquid nitrogen, and stored at –80°C. Left ventricular hypertrophy was evaluated by the LV wet weight to body weight ratio.
Histological studies. For histologic analysis, the hearts were subsequently fixed in 4% paraformaldehyde and embedded in paraffin. Coded slices stained with Masson trichrome were microscopically evaluated for interstitial and perivascular myocardial collagen deposition.
Hydroxyproline content in myocardial extracts. The hydroxyproline content in myocardial extracts was measured and used as an index of collagen content. The apical site of the LV below the papillary muscles was removed, immediately placed in liquid nitrogen, and stored at –80°C until measurement of the hydroxyproline content, according to the method of Stegemann and Stalder (19). The results were calculated as hydroxyproline content per wet weight of tissue.
Reverse transcription-polymerase chain reaction (RT-PCR) analysis of procollagen I and III, IL-6, COX-2, VCAM-1, and MCP-1 mRNA. To evaluate whether fenofibrate ameliorates myocardial fibrosis not only at the histologic and hydroxyproline levels but also at the molecular level, we investigated mRNA expression of procollagen I and III in the LV of the three groups. Furthermore, mRNA expression of IL-6, COX-2, VCAM-1, and MCP-1 was determined. The mRNA expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was also determined as an internal control. Total RNA from the LV was isolated by the method of acid guanidinium thiocyanate/phenol/chloroform extraction with ISOGEN (Nippon Gene Ltd., Tokyo, Japan), according to methods described in our previous reports (16–18) . Semiquantitative RT-PCR was also performed according to our previous article (20). The sequences of the specific primers were as follows: procollagen I (sense): 5'CATAAAGGGTCATCGTGGCTTC3'; procollagen I (antisense): 5'GTGATAGGTGATGTTCTGGGAG3'; procollagen III (sense): 5'GTGACAGAGGTGAAAGAGGATC3'; procollagen III (antisense): 5'CTGTCTTGCTCCATTCACCAGT3'; IL-6 (sense): 5'GTATGAACAGCGATGATGC3'; IL-6 (antisense): 5'CATATTGCCAGTTCTTCGTA3'; COX-2 (sense): 5'GTATGACACAACAGCCCATCTC3'; COX-2 (antisense): 5'CTTGTCAGAACCCCCTCCAATT3'; VCAM-1 (sense): 5'CCTGAACTCCTTGCACTCTACT3'; VCAM-1 (antisense): 5'CAACAGTCAGTCCAAGCAACAC3'; MCP-1 (sense): 5'ACCTGCTGCTACTCATTCACTG3'; MCP-1 (antisense): 5'GTGGTTGTGGAAAAGAGAGTGG3'; GAPDH (sense): 5'GCCATCAACGACCCCTTCATTG3'; GAPDH (antisense): 5'TGCCAGTGAGCTTCCCGTTC3'.
Polymerase chain reaction was performed with the annealing temperature and required cycles for each template as follows: 59°C for procollagen I, 62°C for procollagen III, 62°C for IL-6, 59°C for COX-2, 61°C for VCAM-1, 62°C for MCP-1, and 62°C for GAPDH. The amplified products on agarose gel were stained with ethidium bromide, visualized with a ultraviolet transilluminator, and photographed. The photographs were scanned (CanoScan 600, Canon Ltd., Tokyo, Japan), and quantification was performed with MacBAS (Fuji Film Ltd., Tokyo, Japan).
Detection of NF-kappa-B activation. To determine NF-kappa-B activity, we used a BD Mercury TransFactor kit (BD Biosciences Clontech, Tokyo, Japan). Using an ELISA-based format, the TransFactor kit detected DNA binding by specific transcription factors (21). The consensus binding sequence for the NF-kappa-B p65 subunit was GGGGTATTTCC (22). Absorbance was measured at 655 nm with a microplate reader (Biolumin 960, Molecular Dynamics, Inc., Sunnyvale, California). Five rats in each group were used, and 100 µg nuclear protein was applied for each sample. Nuclear proteins were isolated from the heart to estimate NF-kappa-B translocation. In short, 70 mg of LV from heart tissue was homogenized in ice-cold Tris-buffered saline and centrifuged at 3,000g for 5 min at 4°C. The pellet was resuspended by gentle pipetting in 0.8 ml of ice-cold hypotonic buffer containing 10 mmol/l HEPES, pH 7.9, 10 mmol/l KCl, 0.1 mmol/l EDTA, 0.1 mmol/l EGTA, 1 mmol/l dithiothreitol, 0.5 mmol/l phenylmethane sulfonyl fluoride, 50 mmol/l NaF, 30 mmol/l beta-glycerolphosphate, 1 mmol/l Na3VO4, and 10 µg/ml each of aprotinin, pepstatin, and leupeptin. The solution was allowed to swell on ice for 15 min after addition of 100 µl of 10% Nonidet P-40 (Wako, Osaka, Japan), and the tube was vortexed vigorously for 45 s. The homogenate was centrifuged for 30 s at 4°C in a microcentrifuge tube. The supernatant containing cytoplasmic protein was stored at –80°C. The nuclear pellet was resuspended in a solution containing 20 mmol/l HEPES, pH 7.9, 0.4 mol/l NaCl, 1 mmol/l EDTA, 1 mmol/l EGTA, 1 mmol/l DTT, 1 mmol/l PMSF, and 10 µg/ml each of aprotinin, pepstatin, and leupeptin. The tubes were shaken vigorously at 4°C for 30 min on a shaking platform. The nuclear extracts were stored at –70°C. The protein concentration was estimated using a Pierce protein assay kit (Wako, Osaka, Japan).
Western blot analysis of I-kappa-B-alpha. Cytoplasmic proteins (10 µg) from each sample were mixed with sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE) sample buffer containing 62 mmol/l Tris, pH 6.8, 10% glycerol, 2% SDS, 5% beta-mercaptoethanol, and 0.003% bromophenol blue, heated at 95°C for 5 min and separated by 12.5% SDS-PAGE electrophoresis. The proteins were transferred onto Immobilon transfer membranes (Millipore, Tokyo, Japan). The I-kappa-B proteins were detected using I-kappa-B-alpha antibody (New England Biolabs, Tokyo, Japan), horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (Amersham, Tokyo, Japan) and Enhanced ChemiLuminescence (ECL plus from Amersham) reagents.
Statistical analysis. All data are expressed as the mean value ± SEM. One-way analysis of variance followed by Bonferroni correction for post hoc tests was used for statistical comparison among the various treatment groups. All statistical comparisons were performed with StatView version 5.0 for Windows (SAS Institute Inc., Cary, North Carolina). Values of p < 0.05 were considered statistically significant.
|
Results |
|---|
|
TopAbstractMethodsResultsDiscussionReferences |
|---|
|
|
|
|
|
|
|
|
Discussion |
|---|
|
TopAbstractMethodsResultsDiscussionReferences |
|---|
Relationship of myocardial fibrosis and diastolic dysfunction. Burlew and Weber (23) pointed out the importance of myocardial fibrosis as a cause of diastolic dysfunction. Myocardial fibrosis has been demonstrated in the postmortem human heart and in endomyocardial biopsy tissue in hypertensive heart disease. The amount of collagen present in the myocardium has also been reported to represent the most significant factor related to echocardiographic demonstration of diastolic dysfunction in hypertensive heart disease (24). In an in vivo study, Brilla et al. (25) also demonstrated a close relationship between myocardial fibrosis and myocardial diastolic dysfunction in genetic hypertensive rats with HF. The present study demonstrated both myocardial fibrosis and myocardial diastolic dysfunction in the heart of DOCA-salt hypertensive rats. These results emphasize the crucial role of myocardial fibrosis in the development of diastolic HF.
In the present study, fenofibrate administration inhibited the elevation of LVEDP in DOCA-salt hypertensive rats. Iglarz et al. (26) recently reported in their study that DOCA-salt and fenofibrate did not affect LVEDP in rats. Their observations, however, were made after DOCA-salt treatment for only three weeks. The duration of their study is considered to be too short to elevate LVEDP. We performed our study after five weeks.
Myocardial fibrosis is not constantly associated with LV hypertrophy. In the present study, LV hypertrophy was found in both groups of DOCA-V and DOCA-F rats, but myocardial fibrosis was dominant only in DOCA-V rats. The present data suggest that myocardial hypertrophy itself does not necessarily induce deposition of collagen in the myocardium. Nicoletti and Michel (27), in their review, argued that cardiomyocyte hypertrophy and the development of fibrosis in hypertensive heart disease are independent phenomena.
Relationship between myocardial fibrosis and inflammation. In several fibrotic processes, the role of inflammation has been clearly demonstrated. Several hypertension models revealed that perivascular fibrosis was often associated with inflammatory cell infiltration around small arteries in the myocardium (27). Profibrogenic cytokines are indeed released by inflammatory cells (28). Increased wall tension distributed throughout the whole coronary arterial tree may be involved in the extravasation of inflammatory cells around vessels, and then various cytokines from infiltrating cells, such as macrophages, become a trigger for perivascular and interstitial fibrosis. Morphologically, Hinglais et al. (29) demonstrated in the myocardium of hypertensive rats that interstitial fibroblasts expressing procollagen mRNA were localized near macrophages that infiltrated the myocardium. Since Shahar et al. (30) demonstrated that fibroblast proliferation in human interstitial lung disease was related to IL-6, inflammatory cells, such as macrophages and lymphocytes, may release cytokines that can act on cardiac resident interstitial fibroblasts.
The PPAR-alpha activator attenuates myocardial fibrosis by preventing inflammation. It has been generally accepted that NF-kappa-B is an early transcriptional factor that modulates gene expression in various situations requiring a rapid inflammatory response (31). For example, NF-kappa-B activates numerous genes, including those for adhesion molecules involved in recruitment of circulating leukocytes to sites of inflammation. The prototypic inducible form of NF-kappa-B is a heterodimer composed of p50 (NF-kappa-B1) and p65 (Rel A) subunits, which both belong to the NF-kappa-B/Rel family of proteins. Inactive NF-kappa-B is present in the cytoplasm complexed with the inhibitory protein I-kappa-B-alpha. Nuclear factor-kappa-B is activated by a number of incoming signals from the cell surface. When released from I-kappa-B-alpha by phosphorylation via activation of I-kappa-B kinase, NF-kappa-B translocates to the nucleus and binds to the kappa-B motif of the target gene, which in turn causes activation of several factors involved in inflammatory responses.
Delerive et al. (32) demonstrated that PPAR-alpha activators induced the expression of I-kappa-B-alpha in human aortic smooth muscle cells, and they agued that the increase of I-kappa-B-alpha inhibits NF-kappa-B translocation to the nucleus and binding to the kappa-B motif. Staels et al. (2) also reported in human aortic smooth muscle cells that PPAR-alpha activation inhibits cytokine-induced activation of a number of inflammatory genes, such as VCAM-1, COX-2, and IL-6, by negatively interfering with NF-kappa-B transcriptional activity (33). Furthermore, Watanabe et al. (4) recently reported the development of myocardial fibrosis in PPAR-alpha-null mice. Therefore, we hypothesized that PPAR-alpha activators may prevent inflammation through the NF-kappa-B pathway and myocardial stiffness caused by fibrosis. In the present study, we tried to confirm this speculation in the pressure-overloaded heart of DOCA-salt rats. Activation of NF-kappa-B was increased in the heart of DOCA-salt rats, and there was upregulated mRNA expression of COX-2, VCAM-1, MCP-1, and IL-6. Furthermore, a PPAR-alpha activator, fenofibrate, attenuated NF-kappa-B nuclear binding activity and normalized cytoplasmic I-kappa-B-alpha protein expression.
Study limitations. As a limitation of this study, it should be pointed out that another mechanism exists in myocardial fibrosis besides inflammatory responses through the NF-kappa-B signaling pathway. We previously reported that fenofibrate treatment inhibited endothelin-1 mRNA levels in a model of aortic banding in rats (10). This result suggests that the PPAR-alpha activator may inhibit myocardial fibrosis by suppressing endothelin-1 production. However, the NF-kappa-B signaling pathway may have an independent association with the effect of endothelin-1, because endothelin-1 does not stimulate the NF-kappa-B pathway directly.
Conclusions. We demonstrated that prolonged hypertension induced myocardial fibrosis and diastolic dysfunction (diastolic HF), and that these disorders were clearly prevented by treatment with fenofibrate. From molecular analyses, we concluded that the effects of fenofibrate were dependent on inhibition of the inflammatory response through the NF-kappa-B pathway. Therapy with PPAR-alpha activators in patients with hypertensive heart disease may provide a new therapeutic strategy against the final development of diastolic HF in this disorder.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
|
References |
|---|
|
TopAbstractMethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  P. J. H. Smeets, B. E. J. Teunissen, A. Planavila, H. de Vogel-van den Bosch, P. H. M. Willemsen, G. J. van der Vusse, and M. van Bilsen Inflammatory Pathways Are Activated during Cardiomyocyte Hypertrophy and Attenuated by Peroxisome Proliferator-activated Receptors PPAR{alpha} and PPAR{delta} J. Biol. Chem., October 24, 2008; 283(43): 29109 - 29118. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Koleganova, G. Piecha, E. Ritz, and M.-L. Gross Calcitriol ameliorates capillary deficit and fibrosis of the heart in subtotally nephrectomized rats Nephrol. Dial. Transplant., October 1, 2008; (2008) gfn549v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-Y. Huang, J.-W. Liao, Y.-C. Liu, S.-Y. Lu, C.-P. Chou, W.-H. Chan, S.-U. Chen, and T.-H. Ueng Motorcycle Exhaust Induces Reproductive Toxicity and Testicular Interleukin-6 in Male Rats Toxicol. Sci., May 1, 2008; 103(1): 137 - 148. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. A. Elmarakby, J. E. Quigley, J. D. Imig, J. S. Pollock, and D. M. Pollock TNF-{alpha} inhibition reduces renal injury in DOCA-salt hypertensive rats Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2008; 294(1): R76 - R83. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. Tordjman, C. F. Semenkovich, T. Coleman, R. Yudovich, S. Bak, E. Osher, M. Vechoropoulos, and N. Stern Absence of Peroxisome Proliferator-Activated Receptor-{alpha} Abolishes Hypertension and Attenuates Atherosclerosis in the Tsukuba Hypertensive Mouse Hypertension, November 1, 2007; 50(5): 945 - 951. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Xu, S. R. Farmer, and B. D. Smith Peroxisome Proliferator-activated Receptor {gamma} Interacts with CIITA{middle dot}RFX5 Complex to Repress Type I Collagen Gene Expression J. Biol. Chem., September 7, 2007; 282(36): 26046 - 26056. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. K. LeBrasseur, T.-A. S. Duhaney, D. S. De Silva, L. Cui, P. C. Ip, L. Joseph, and F. Sam Effects of Fenofibrate on Cardiac Remodeling in Aldosterone-Induced Hypertension Hypertension, September 1, 2007; 50(3): 489 - 496. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. E.J. Teunissen, P. J.H. Smeets, P. H.M. Willemsen, L. J. De Windt, G. J. Van der Vusse, and M. Van Bilsen Activation of PPAR{delta} inhibits cardiac fibroblast proliferation and the transdifferentiation into myofibroblasts Cardiovasc Res, August 1, 2007; 75(3): 519 - 529. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. L. King, M. E. Young, J. Kerner, H. Huang, K. M. O'Shea, S. E. H. Alexson, C. L. Hoppel, and W. C. Stanley Diabetes or peroxisome proliferator-activated receptor {alpha} agonist increases mitochondrial thioesterase I activity in heart J. Lipid Res., July 1, 2007; 48(7): 1511 - 1517. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T.-A. S. Duhaney, L. Cui, M. K. Rude, N. K. Lebrasseur, S. Ngoy, D. S. De Silva, D. A. Siwik, R. Liao, and F. Sam Peroxisome Proliferator-Activated Receptor {alpha}-Independent Actions of Fenofibrate Exacerbates Left Ventricular Dilation and Fibrosis in Chronic Pressure Overload Hypertension, May 1, 2007; 49(5): 1084 - 1094. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. d. l. Fuentes, A. L. Brown, S. J. Mathews, A. D. Waggoner, P. F. Soto, R. J. Gropler, and V. G. Davila-Roman Metabolic syndrome is associated with abnormal left ventricular diastolic function independent of left ventricular mass Eur. Heart J., March 1, 2007; 28(5): 553 - 559. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Johar, A. C. Cave, A. Narayanapanicker, D. J. Grieve, and A. M. Shah Aldosterone mediates angiotensin II-induced interstitial cardiac fibrosis via a Nox2-containing NADPH oxidase FASEB J, July 1, 2006; 20(9): 1546 - 1548. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Hermann and F. Ruschitzka Novel anti-inflammatory drugs in hypertension Nephrol. Dial. Transplant., April 1, 2006; 21(4): 859 - 864. [Full Text] [PDF]
|
|
|
|
|
|
M. J. Goikoetxea, J. Beaumont, A. Gonzalez, B. Lopez, R. Querejeta, M. Larman, and J. Diez Altered cardiac expression of peroxisome proliferator-activated receptor-isoforms in patients with hypertensive heart disease Cardiovasc Res, March 1, 2006; 69(4): 899 - 907. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Sun, O. A. Carretero, J. Xu, N.-E. Rhaleb, F. Wang, C. Lin, J. J. Yang, P. J. Pagano, and X.-P. Yang Lack of Inducible NO Synthase Reduces Oxidative Stress and Enhances Cardiac Response to Isoproterenol in Mice With Deoxycorticosterone Acetate-Salt Hypertension Hypertension, December 1, 2005; 46(6): 1355 - 1361. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. H. Han, M. J. Quon, and K. K. Koh Beneficial Vascular and Metabolic Effects of Peroxisome Proliferator-Activated Receptor-{alpha} Activators Hypertension, November 1, 2005; 46(5): 1086 - 1092. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. N. Petrashevskaya and A. Schwarz Peroxisome proliferator-activated receptor {beta}/{delta}: a new antihypertrophic drug target? Cardiovasc Res, March 1, 2005; 65(4): 770 - 771. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | SUBSCRIPTIONS | CURRENT ISSUE | PAST ISSUES | CARDIOSOURCE | SEARCH | HELP |
p < 0.05 vs. DOCA-V. Abbreviations as in 
