Advertisement

Click here for more guidelines.

 
 




CME Topic Collections Past Issues Search Current Issue Home
     

J Am Coll Cardiol, 2003; 42:661-667, doi:10.1016/S0735-1097(03)00781-2
© 2003 by the American College of Cardiology Foundation
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bojesen, S. E.
Right arrow Articles by Nordestgaard, B.o. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bojesen, S. E.
Right arrow Articles by Nordestgaard, B.o. G.

CLINICAL RESEARCH: ACUTE MYOCARDIAL INFARCTION

Platelet glycoprotein IIb/IIIa PlA2/PlA2 homozygosity associated with risk of ischemic cardiovascular disease and myocardial infarction in young men

The Copenhagen City Heart Study

Stig E. Bojesen, MD, PhD*, Klaus Juul, MD*, Peter Schnohr, MD{dagger}, Anne Tybjærg-Hansen, MD, DMSc{dagger}{ddagger} and B.ørge G. Nordestgaard, MD, DMSc*{dagger},*

* Department of Clinical Biochemistry, Herlev University Hospital, Herlev, Denmark
{dagger} The Copenhagen City Heart Study, Bispebjerg University Hospital, Copenhagen, Denmark
{ddagger} Department of Clinical Biochemistry, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark

Manuscript received January 28, 2003; revised manuscript received April 25, 2003, accepted May 9, 2003.

* Reprint requests and correspondence: Dr. Børge G. Nordestgaard, Department of Clinical Biochemistry, Herlev University Hospital, Herlev Ringvej 75, DK-2730 Herlev, Denmark.
brno{at}herlevhosp.kbhamt.dk


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
OBJECTIVES: We tested the hypothesis that platelet glycoprotein (GP) IIb/IIIa PlA2/PlA2 homozygotes or PlA1/PlA2 heterozygotes versus PlA1/PlA1 noncarriers have increased risk of ischemic cardiovascular disease and myocardial infarction (MI), stratified for age and gender.

BACKGROUND: The GP IIb/IIIa PlA1/PlA2 polymorphism influences aggregation of platelets; however, an association between ischemic cardiovascular disease and heterozygosity remains controversial, and association with homozygosity is largely unexplored.

METHODS: We genotyped the participants of the Copenhagen City Heart Study, a prospective cardiovascular investigation of the Danish general population (n = 9,149, 22-year follow-up) and assessed the risk of ischemic cardiovascular disease in heterozygotes or homozygotes versus noncarriers.

RESULTS: Of the participants, 70.0%, 27.3%, and 2.7% were noncarriers, heterozygotes, or homozygotes, respectively. Incidence of ischemic cardiovascular disease was 167 and 103 per 10,000 person-years in homozygous and noncarrier men (log-rank: p = 0.006), whereas this difference was not observed in women (p = 0.33) (genotype·gender interaction: p = 0.03). In homozygous versus noncarrier men <40 years of age, 40 to 50 years, and >50 years at entry, age-adjusted relative risks (RRs) of ischemic cardiovascular disease were 3.6 (1.4 to 9.0), 2.4 (1.3 to 4.6), and 1.0 (0.6 to 1.8), respectively (age·genotype interaction in men: p = 0.04); equivalent multifactorially adjusted RRs were 3.0 (1.1 to 8.0), 2.0 (1.0 to 3.9), and 1.0 (0.6 to 1.8), respectively. The corresponding age-adjusted RR values of MI in men were 5.2 (1.5 to 18), 3.5 (1.6 to 7.5), and 0.5 (0.1 to 1.5), respectively (age·genotype interaction in men: p = 0.002); equivalent multifactorially adjusted RRs were 3.8 (1.0 to 15), 3.1 (1.4 to 6.9), and 0.5 (0.2 to 1.5), respectively.

CONCLUSIONS: PlA2/PlA2 homozygosity is associated with a three-fold and four-fold risk of ischemic cardiovascular disease and MI in young men.

Abbreviations and Acronyms
  CI = confidence interval
  GP = glycoprotein
  ICD = International Classification of Diseases
  MI = myocardial infarction
  RR = relative risk


Binding of adhesive plasmaproteins as von Willebrand factor and fibrinogen to membrane-bound glycoprotein (GP) IIb/IIIa of platelets plays a pivotal role in platelet aggregation (1). The PlA1/PlA2 polymorphism, also called HPA-1a/HPA-1b or Zw(a)/Zw(b), causes a substitution of the wild-type Leu-33 to proline in the ß3-subunit of GP IIb/IIIa, resulting in an extracellularly positioned conformational change of the ß3-subunit. Therefore, it has been considered biologically plausible to suggest an impact of Leu33Pro on platelet aggregation (2), and consequently on risk of ischemic cardiovascular disease (3).

In a recent meta-analysis (4) of mainly case-control studies with conflicting results encompassing more than 17,000 individuals, aggregated results showed an odds ratio for ischemic cardiovascular disease in PlA1/PlA2 heterozygotes combined with PlA2/PlA2 homozygotes versus PlA1/PlA1 noncarriers of 1.10 (95% confidence interval [CI] 1.03 to 1.18). Only two prospective studies have been published so far (5,6), and all studies published have been too small to specifically investigate homozygosity, let alone having been stratified for age and gender.

We tested the hypothesis that platelet GP IIb/IIIa homozygotes or heterozygotes versus noncarriers have increased risk of ischemic cardiovascular disease and myocardial infarction (MI), overall or stratified for age and gender. For this purpose we used the Copenhagen City Heart Study, a prospective cardiovascular study of the Danish general population with 9,149 participants and a total of 22 years' follow-up.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
From the Danish general population, by use of the Danish Central Population Register number, we randomly recruited 4,082 men and 5,067 women who participated in the third examination of the Copenhagen City Heart Study, 1991 to 1994 (7–12). Participants were screened for manifestations of ischemic cardiovascular disease (MI, non-MI ischemic heart disease, or ischemic stroke) by a questionnaire during 1976 to 1978, 1981 to 1983, and 1991 to 1994, and by reviewing all 1976 to 1998 hospital admissions and diagnoses entered in the Danish National Hospital Discharge Register (13), all 1991 to 1998 causes of deaths entered in the Danish National Register of Causes of Death, and medical records from hospitals and general practitioners.

Myocardial infarction was classified according to World Health Organization International Classification of Diseases 8th ed. (ICD-8) code 410, or 10th ed. (ICD-10) codes I21-I22. Non-MI ischemic heart disease was ICD-8 codes 411-413 or ICD-10 codes I20 and I25: diagnosis was based on characteristic symptoms of stable angina pectoris according to the guidelines of the European Society of Cardiology (location, character, and duration of pain and the relation of pain to exercise [14]).

Ischemic stroke was ICD-8 codes 432-434 or ICD-10 code I63, excluding computed tomography proven hematoma, subarachnoidal hemorrhage, or transient ischemic attack. Individual diagnoses were verified by experienced cardiologists and neurologists, respectively (15). Participants with disease before study entry were excluded from the study (n = 93).

We had 99.97% follow-up; three individuals were lost. More than 99% were whites of Danish descent. All participants gave written informed consent. The ethical committees of Copenhagen and Frederiksberg approved the study (No. 100.2039/91).

The PlA2-allele, also called HPA-1b or Zw(b), is caused by a T->C substitution in nucleotide 176 after A in the start-codon in the gene integrin ß3 (GenBank AccNo NM_000212 [GenBank] ). This polymorphism was examined as earlier described (16): in short, a 268-bp polymerase chain reaction-fragment covering the whole of exon 3 (GenBank AccNo M32672) was amplified from genomic deoxyribonucleic acid by the use of intronic primers: sense: TTCTGATTGCTGGACTTCTCTT; antisense: TCTCTCCCCACGGCAAAGAGT. After thermocycling, the polymerase chain reaction was digested with the restriction endonuclease MspI, run on a 3% agarose gel and visualized using ethidium bromide. The PlA1/PlA1 noncarrier genotype produced a 221/38/8-bp-pattern, PlA1/PlA2 heterozygous genotype a 221/177/44/38/8-bp-pattern, and PlA2/PlA2 homozygous genotype a 177/44/38/8-bp-pattern.

Blood samples were drawn in the nonfasting state. Colorimetric and turbidimetric assays were used to measure plasma levels of total cholesterol, high-density lipoprotein cholesterol, triglycerides, fibrinogen (all Boehringer Mannheim, Mannheim, Germany), and lipoprotein(a) total mass (DAKO A/S, Glostrup, Denmark). The diagnosis of diabetes mellitus was assigned according to participants' own knowledge of their disease status. The status of smoker was assigned to current and former smokers.

The statistical software package SPSS (SPSS for Windows, release 10.0.7, SPSS Inc., Chicago, Illinois) was used. A p value <0.05 on a two-sided test was considered significant. For characteristics of participants, we used the Student t test on untransformed or log-transformed variables, Mann-Whitney U test, or the Pearson chi-square test. Multifactorial adjustment included all other parameters listed in Table 1 in an analysis of covariance or logistic regression model. Continuous variables were divided in gender-specific tertiles. It was decided a priori to stratify main analyses for gender and age. We plotted cumulative disease incidence against follow-up time using the Kaplan-Meier method, and we tested differences between genotypes using log-rank statistics. Visual inspection of log-minus-log curves was employed to exclude disproportion of hazards over time. Relative risk for disease with 95% CI was calculated using the Cox regression, unadjusted, adjusted for age at entry in decades, or all the factors listed in Table 1 (multifactorial adjustment). We tested for multiplicative interactions among gender, age, and genotype-status in predicting disease, by introducing two-factor interaction terms after inclusion of individual parent terms in the Cox regression model.


View this table:
[in this window]
[in a new window]
 
Table 1 Characteristics of Participants

 

    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
We genotyped 9,149 participants from the Danish general population. Of those, 70.0%, 27.3%, and 2.7% were PlA1/PlA1 noncarriers, PlA1/PlA2 heterozygotes, and PlA2/PlA2 homozygotes, respectively. This distribution did not differ from Hardy-Weinberg equilibrium (chi-square test: all, p = 0.81; men, p = 0.97; women, p = 0.77; Table 2). Allele frequencies of the PlA1-allele and PlA2-allele were 83.6/16.4% overall, 83.6/16.4% in men, and 83.7/16.3% in women. Established risk factors for ischemic cardiovascular disease, except for fibrinogen in men, diabetes and hypertension in women, and lipoprotein(a) in both genders, were evenly distributed among the three genotypes (Table 1). Most of these differences were likely due to chance, and none would remain significant after correction for multiple comparison. In contrast, many differences existed in risk factor distribution between men and women (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 2 Incidence and Relative Risk of Ischemic Cardiovascular Disease and Myocardial Infarction in PlA1/PlA2 Heterozygotes or PlA2/PlA2 Homozygotes Versus PlA1/PlA1 Noncarriers by Cox Regression Analysis

 
Incidence of ischemic cardiovascular disease in homozygous and noncarrier men was 167 and 103 per 10,000 person-years (log-rank: p = 0.006) (Fig. 1, Table 2). In an age-adjusted Cox regression model, RR of ischemic cardiovascular disease in homozygotes versus noncarriers was 1.5 (95% CI 1.1 to 2.2) and 0.7 (95% CI 0.4 to 1.4) in men and women, respectively (Table 2). In accordance with this gender difference, gender and (homozygous vs. noncarrier) genotype interacted on ischemic cardiovascular disease (p =0.03). For the end point of MI, the results were similar to those for ischemic cardiovascular disease; however, statistical significance was not reached (Table 2). Heterozygotes did not differ from noncarriers with respect to incidence or risk of ischemic cardiovascular disease or MI in either gender (Table 2). Unadjusted and multifactorial adjusted models gave results similar to age-adjusted models (Table 2).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1 Kaplan-Meier curves showing 22-year cumulative incidence of ischemic cardiovascular disease according to PlA genotype for men and women combined, men alone, and women alone.

 
In homozygous versus noncarrier men aged <40 years, 40 to 50 years, and >50 years at entry, age-adjusted RR values of ischemic cardiovascular disease were 3.6 (1.4 to 9.0), 2.4 (1.3 to 4.6), and 1.0 (0.6 to 1.8), respectively (genotype·age interaction in men: p = 0.04; Table 3); equivalent multifactorially adjusted RR values were 3.0 (1.1 to 8.0), 2.0 (1.0 to 3.9), and 1.0 (0.6 to 1.8), respectively. The corresponding age-adjusted RRs of MI in men were 5.2 (1.5 to 18), 3.5 (1.6 to 7.5), and 0.5 (0.1 to 1.5), respectively (age·genotype interaction in men: p = 0.002); equivalent multifactorially adjusted RRs were 3.8 (1.0 to 15), 3.1 (1.4 to 6.9), and 0.5 (0.2 to 1.5), respectively. In women, homozygosity versus noncarrier status did not predict ischemic cardiovascular disease or MI in either age group (Table 3). Likewise, heterozygosity versus noncarrier status did not predict either end point in either age group in men or women. Unadjusted and multifactorial adjusted models gave results similar to age-adjusted models (Table 3).


View this table:
[in this window]
[in a new window]
 
Table 3 Incidence and Relative Risk of Ischemic Cardiovascular Disease and Myocardial Infarction in PlA1/PlA2 Heterozygotes or PlA2/PlA2 Homozygotes Versus PlA1/PlA1 Noncarriers by Cox Regression, Stratified by Age

 
Fibrinogen, a well-recognized predictor of MI (17,18) directly interacting with platelet GP IIb/IIIa in aggregation of platelets, is in our study higher among PlA2/PlA2 men than among PlA1/PlA2 heterozygous or PlA1/PlA1 noncarrier men (Table 1). Accordingly, fibrinogen level could confound the association between disease and homozygosity in men; however, after multifactorial adjustment (including fibrinogen), the RR for homozygous men remained elevated (Tables 2 and 3).

Age at first MI was 61 ± 2.5 years (mean ± SE) and 66 ± 0.5 years in homozygous and noncarrier men (Table 4; Mann Whitney U test: p = 0.03); equivalent values for ischemic cardiovascular disease were 64 ± 2.0 and 67 ± 0.5 years (p = 0.07). This difference was not observed between homozygotes and noncarrier women, or between heterozygotes and noncarriers of either gender (Table 4) .


View this table:
[in this window]
[in a new window]
 
Table 4 Age at First Event in PlA1/PlA2 Heterozygotes, PlA2/PlA2 Homozygotes, and PlA1/PlA1 Noncarriers

 
The unadjusted RRs of death due to MI with seven years of follow-up (1991 to 1994 through 1998) for noncarriers, heterozygotes, and homozygotes were 1.0, 0.8 (95% CI 0.5 to 1.3), and 1.8 (95% CI 0.7 to 5.0) for men and 1.0, 1.0 (95% CI 0.5 to 2.2), and 1.1 (95% CI 0.2 to 8.4) for women, respectively. Only 81 (59 noncarrier, 18 heterozygous, and 4 homozygous) men and 33 (23 noncarrier, 9 heterozygous, and 1 homozygous) women died of MI during this short period; therefore, the statistical power is much less in these analyses on mortality compared with the analyses on morbidity.


    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
This study reports an increased risk of ischemic cardiovascular disease and MI in young men homozygous for the platelet GP IIb/IIIa PlA2/PlA2 compared to noncarrier PlA1/PlA1 young men over 22 years of follow-up in a large Danish cohort.

The more than 30 case-control studies published about this polymorphism and risk of ischemic cardiovascular disease reach divergent results (3,4). Two factors complicate a direct comparison of our results with the findings of others. Most importantly, the majority of previous studies combine PlA1/PlA2 heterozygotes and PlA2/PlA2 homozygotes versus PlA1/PlA1 noncarriers in their calculations in order to obtain sufficient statistical power, and thus do not study homozygotes alone. Second, most previous studies did not investigate associations stratified on gender or age, which proved essential in our work. Our study suggests an association between homozygosity and ischemic cardiovascular disease in men, but not in women. This association is most pronounced in men <40 years of age, an age group where very few women are affected. Among the group 40 to 50 years of age, we do find cases among women and also an elevated relative risk for ischemic cardiovascular disease in homozygous men, but not in homozygous women, thus supporting the gender-specific association.

Contrary to most other reports, we do not find any increased risk of ischemic cardiovascular disease among PlA1/PlA2 heterozygotes versus PlA1/PlA1 noncarriers. Several factors could contribute to this discrepancy: publication bias toward positive results in small studies (4), different ethnicity between studies, differences in study design, and chance alone. Our study is the largest so far and, together with the two other published prospective studies (5,6), agree that PlA1/PlA2 heterozygosity does not increase the risk of ischemic cardiovascular disease.

Of the many in vitro studies examining the impact of the PlA2-allele on platelet function, two (19,20) investigated all three genotypes separately. In these studies, PlA2 was associated with increased platelet aggregability, and thus the propensity to initiate thrombus formation, in a gene-dose dependent manner. Biologically, the observation of increased risk of ischemic cardiovascular disease in PlA2/PlA2 homozygotes therefore seems reasonable. However, this remains an untested correlation that may or may not explain the enhanced risk of homozygotes reported in our study.

Interestingly, when exposed to physiologic concentrations of estrogen, the aggregability of PlA1/PlA2 heterozygous platelets was inhibited more than PlA1/PlA1 noncarrier platelets (21). This accords with our data, which demonstrate an association between PlA2/PlA2 homozygosity and ischemic cardiovascular disease in men only.

Prothrombotic conditions like increased platelet aggregability is believed by some investigators (22,23) to outweigh the importance of atherosclerosis in premature MI, mainly because of their findings of fewer stenoses on coronary angiography in young patients when compared with old patients with MI. Therefore, having the above-mentioned in vitro studies on PlA-genotype and platelet aggregability in mind (19–21,24), our finding of age-dependency in men of the effect of the PlA2/PlA2-genotype on MI could simply be caused by increased platelet aggregability induced by the PlA2/PlA2-genotype operating at an early age.

In a series of autopsy studies on men, Mikkelsson et al. (25–28) reported lower incidence of atherosclerotic lesions but higher incidence of coronary thrombosis among PlA2-carriers than among PlA1/PlA1 noncarriers for participants <60 years, but not for those >60 years. Although the stratification on genotype and age in these studies (age under or above 60 years, genotype noncarriers vs. heterozygotes, and homozygotes combined) differs from our work, those studies nevertheless support our finding of higher risk of disease among younger homozygous men. Unfortunately, no data on the extent of atherosclerosis (including results from coronary angiographies) of the participants of our study are available. Therefore, we do not know whether the young homozygous men in our study have more or less atherosclerosis than expected.

We cannot totally exclude that our findings represent chance findings simply because no other studies have demonstrated this association in young men. However, the association was found in those <40 years old and in 40- to 50-year-old men, and the association decreased stepwise with increasing age.

Another potential limitation of our study is that participants underwent genotyping only if they attended the 1991 to 1994 third examination. The absence of a correlation between PlA2/PlA2 homozygosity and ischemic heart disease in older men could be the result of a dropout of homozygous men at an early age because of premature death or disability. However, the stable Hardy-Weinberg equilibria throughout the age groups (Table 3) do not support such a hypothesis. Furthermore, age percentiles for noncarrier and homozygous men display a linear relationship, as would be expected with no selection against homozygotes (data not shown). Thus, we do not consider selection bias against homozygotes very likely, but if this does apply for our study, it would rather result in a conservative estimate concerning association of the PlA2-genotype with ischemic cardiovascular disease, and thus cannot explain our results.

Systematic misclassification of genotypes in this study is unlikely, because of agreement with the Hardy-Weinberg equilibrium and because the PCR assay included a restriction enzyme site in each person assayed. Misclassification of ischemic cardiovascular disease in the Copenhagen City Heart Study is very low, as we have 99.97% follow-up, and because all hospital admissions as well as deaths are registered systematically throughout Denmark.

Medication given to prevent ischemic cardiovascular disease and MI might overcome an underlying genetic risk. Therefore, another limitation of the present study is that we do not have complete information on all preventive medication given to all participants during the entire 22-year follow-up; however, addition of the use of antihypertensive and cholesterol-lowering medications at the 1991 to 1994 examination to the multifactorially adjusted models only resulted in trivial changes in the RR estimates.

Finally, the main finding of our prospective study in the Copenhagen City Heart Study, with a total follow-up of 163,987 person-years, is the three-fold and four-fold 22-year risk of ischemic cardiovascular disease and MI in men <40 years homozygous for platelet GP IIb/IIIa PlA2/PlA2.


    Acknowledgments
 
The investigators thank Hanne Damm and Mette Refstrup for excellent technical assistance, and the participants of the Copenhagen City Heart Study for their willingness to participate.


    Footnotes
 
The Danish Heart Foundation (Copenhagen), the Danish Medical Research Council (Copenhagen), and the Overlæge Johan Boserup and Lise Boserups Fond (Copenhagen) contributed with financial support.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
1. Lefkovits J, Plow EF, Topol EJ. Platelet glycoprotein IIb/IIIa receptors in cardiovascular medicine. N Engl J Med. 1995;332:1553–1559[CrossRef][Medline]

2. Reiner AP, Siscovick DS, Rosendaal FR. Platelet glycoprotein gene polymorphisms and risk of thrombosis: facts and fancies. Rev Clin Exp Hematol. 2001;5:262–287[CrossRef][Medline]

3. Weiss EJ, Bray PF, Tayback M, et al. A polymorphism of a platelet glycoprotein receptor as an inherited risk factor for coronary thrombosis. N Engl J Med. 1996;334:1090–1094[CrossRef][Medline]

4. Di Castelnuovo A, de Gaetano G, Donati MB, Iacoviello L. Platelet glycoprotein receptor IIIa polymorphism PlA1/PlA2 and coronary risk: a meta-analysis. Thromb Haemost. 2001;85:626–633[Medline]

5. Ridker PM, Hennekens CH, Schmitz C, Stampfer MJ, Lindpaintner K. PlA1/A2 polymorphism of platelet glycoprotein IIIa and risks of myocardial infarction, stroke, and venous thrombosis. Lancet. 1997;349:385–388[CrossRef][Medline]

6. Aleksic N, Juneja H, Folsom AR, et al. Platelet PlA2 allele and incidence of coronary heart disease—results from the Atherosclerosis Risk In Communities (ARIC) study. Circulation. 2000;102:1901–1905[Abstract/Free Full Text]

7. Agerholm-Larsen B, Nordestgaard BG, Steffensen R, Sorensen TI, Jensen G, Tybjærg-Hansen A. ACE gene polymorphism: ischemic heart disease and longevity in 10,150 individuals. A case-referent and retrospective cohort study based on the Copenhagen City Heart Study. Circulation. 1997;95:2358–2367[Abstract/Free Full Text]

8. Agerholm-Larsen B, Nordestgaard BG, Steffensen R, Jensen G, Tybjærg-Hansen A. Elevated HDL cholesterol is a risk factor for ischemic heart disease in white women when caused by a common mutation in the cholesteryl ester transfer protein gene. Circulation. 2000;101:1907–1912[Abstract/Free Full Text]

9. Agerholm-Larsen B, Tybjærg-Hansen A, Schnohr P, Steffensen R, Nordestgaard BG. Common cholesteryl ester transfer protein mutations, decreased HDL cholesterol, and possible decreased risk of ischemic heart disease: the Copenhagen City Heart Study. Circulation. 2000;102:2197–2203[Abstract/Free Full Text]

10. Frikke-Schmidt R, Tybjærg-Hansen A, Steffensen R, Jensen G, Nordestgaard BG. Apolipoprotein E genotype: {varepsilon}32 women are protected while {varepsilon}43 and {varepsilon}44 men are susceptible to ischemic heart disease. The Copenhagen City Heart Study. J Am Coll Cardiol. 2000;35:1192–1199[Abstract/Free Full Text]

11. Tybjærg-Hansen A, Steffensen R, Meinertz H, Schnohr P, Nordestgaard BG. Association of mutations in the apolipoprotein B gene with hypercholesterolemia and the risk of ischemic heart disease. N Engl J Med. 1998;338:1577–1584[CrossRef][Medline]

12. Wittrup HH, Nordestgaard BG, Sillesen H, Schnohr P, Tybjærg-Hansen A. A common mutation in lipoprotein lipase confers a 2-fold increase in risk of ischemic cerebrovascular disease in women but not in men. Circulation. 2000;101:2393–2397[Abstract/Free Full Text]

13. Andersen TF, Madsen M, Jørgensen J, Mellemkjær L, Olsen JH. The Danish National Hospital Register. A valuable source of data for modern health sciences. Dan Med Bull. 1999;46:263–268[Medline]

14. Management of stable angina pectoris. Recommendations of the Task Force of the European Society of Cardiology. Eur Heart J. 1997;18:394–413[Free Full Text]

15. Sethi AA, Tybjærg-Hansen A, Grønholdt ML, Steffensen R, Schnohr P, Nordestgaard BG. Angiotensinogen mutations and risk for ischemic heart disease, myocardial infarction, and ischemic cerebrovascular disease. Six case-control studies from the Copenhagen City Heart Study. Ann Intern Med. 2001;134:941–954[Abstract/Free Full Text]

16. Zimrin AB, Gidwitz S, Lord S, et al. The genomic organization of platelet glycoprotein IIIa. J Biol Chem. 1990;265:8590–8595[Abstract/Free Full Text]

17. Ma J, Hennekens CH, Ridker PM, Stampfer MJ. A prospective study of fibrinogen and risk of myocardial infarction in the Physicians' Health Study. J Am Coll Cardiol. 1999;33:1347–1352[Abstract/Free Full Text]

18. Maresca G, Di Blasio A, Marchioli R, Di Minno G. Measuring plasma fibrinogen to predict stroke and myocardial infarction: an update. Arterioscler Thromb Vasc Biol. 1999;19:1368–1377[Abstract/Free Full Text]

19. Feng DL, Lindpaintner K, Larson MG, et al. Increased platelet aggregability associated with platelet GPIII alpha PlA2 polymorphism—the Framingham Offspring Study. Arterioscler Thromb Vasc Biol. 1999;19:1142–1147[Abstract/Free Full Text]

20. Michelson AD, Furman MI, Goldschmidt-Clermont P, et al. Platelet GP IIIa PlA polymorphisms display different sensitivities to agonists. Circulation. 2000;101:1013–1018[Abstract/Free Full Text]

21. Boudoulas KD, Cooke GE, Roos CM, Bray PF, Goldschmidt-Clermont PJ. The PlA polymorphism of glycoprotein IIIa functions as a modifier for the effect of estrogen on platelet aggregation. Arch Pathol Lab Med. 2001;125:112–115[Medline]

22. Ardissino D, Mannucci PM, Merlini PA, et al. Prothrombotic genetic risk factors in young survivors of myocardial infarction. Blood. 1999;94:46–51[Abstract/Free Full Text]

23. Zimmerman FH, Cameron A, Fisher LD, Ng G. Myocardial infarction in young adults: angiographic characterization, risk factors and prognosis (Coronary Artery Surgery Study Registry). J Am Coll Cardiol. 1995;26:654–661[Abstract]

24. Vijayan KV, Goldschmidt-Clermont PJ, Roos C, Bray PF. The PlA2 polymorphism of integrin ß3 enhances outside-in signaling and adhesive functions. J Clin Invest. 2000;105:793–802[Medline]

25. Mikkelsson J, Perola M, Kauppila LI, et al. The GPIIIa PlA polymorphism in the progression of abdominal aortic atherosclerosis. Atherosclerosis. 1999;147:55–60[CrossRef][Medline]

26. Mikkelsson J, Perola M, Laippala P, Penttila A, Karhunen PJ. Glycoprotein IIIa PlA1/A2 polymorphism and sudden cardiac death. J Am Coll Cardiol. 2000;36:1317–1323[Abstract/Free Full Text]

27. Mikkelsson J, Perola M, Laippala P, et al. Glycoprotein IIIa PlA polymorphism associates with progression of coronary artery disease and with myocardial infarction in an autopsy series of middle-aged men who died suddenly. Arterioscler Thromb Vasc Biol. 1999;19:2573–2578[Abstract/Free Full Text]

28. Mikkelsson J, Perola M, Penttila A, Goldschmidt-Clermont PJ, Karhunen PJ. The GPIIIa (beta3 integrin) PlA polymorphism in the early development of coronary atherosclerosis. Atherosclerosis. 2001;154:721–727[CrossRef][Medline]




This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. S. Williams, E. J. Weiss, M. S. Sabatine, D. I. Simon, W. F. Bahou, L. C. Becker, L. V. Parise, H. L. Dauerman, P. A. French, S. S. Smyth, et al.
Genetic Regulation of Platelet Receptor Expression and Function: Application in Clinical Practice and Drug Development
Arterioscler Thromb Vasc Biol, December 1, 2010; 30(12): 2372 - 2384.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
J. Mikkelsson, M. Perola, and P. J. Karhunen
Genetics of Platelet Glycoprotein Receptors: Risk of Thrombotic Events and Pharmacogenetic Implications
Clinical and Applied Thrombosis/Hemostasis, April 1, 2005; 11(2): 113 - 125.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bojesen, S. E.
Right arrow Articles by Nordestgaard, B.o. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bojesen, S. E.
Right arrow Articles by Nordestgaard, B.o. G.

 
  CME Topic Collections Past Issues Search Current Issue Home

Advertisement