CLINICAL STUDY: HYPERTENSION
Cardiac fibrosis occurs early and involves endothelin and AT-1 receptors in hypertension due to endogenous angiotensin II
Teresa M. Seccia, MD*,
Anna S. Belloni, BSc ,
Reinhold Kreutz, MD ,
Martin Paul, MD ,
Gastone G. Nussdorfer, MD ,
Achille C. Pessina, MD, PhD and
Gian Paolo Rossi, MD, FACC ,*
* Department of Clinical Methodology and Clinical-Surgical Technologies, University of Bari, Bari, Italy
Department of Human Anatomy and Physiology (Section of Anatomy), University of Padova, Padova, Italy
Institute of Clinical Pharmacology and Toxicology, Freie University of Berlin, Berlin, Germany
Department of Clinical and Experimental Medicine, Clinica Medica 4, University of Padova, Padova, Italy
Manuscript received June 19, 2002;
accepted October 17, 2002.
* Reprint requests and correspondence: Dr. Gian Paolo Rossi, Dept. of Clinical and Experimental Medicine, Clinica Medica 4, University Hospital, via Giustiniani, 2, 35126 Padova, Italy. gianpaolo.rossi{at}unipd.it
 |
Abstract
|
|---|
OBJECTIVES: We investigated if endothelin (ET)-1 and the renin-angiotensin-aldosterone system play a role in cardiac fibrosis.
BACKGROUND: Angiotensin II (Ang II) can induce cardiac fibrosis, but the underlying mechanisms are incompletely understood.
METHODS: Four-week-old transgenic (mRen2)27 rat (TGRen2) received for four weeks a placebo, the mixed ETA/ETB endothelin receptor antagonist bosentan, the angiotensin II type I receptor (AT-1) antagonist irbesartan, the ETA endothelin receptor antagonist BMS-182874, and a combined treatment with irbesartan plus BMS-182874. We measured collagen density on Sirius redstained serial sections of the left ventricle (LV) with a photomicroscope equipped with specific software and assessed the gene expression of procollagen 1(I), atrial natriuretic peptide (ANP), transforming growth factor-beta 1 (TGFß1), endothelin converting enzyme, and ETB receptor.
RESULTS: In the placebo group, hypertension was associated with LV hypertrophy and cardiac fibrosis (LV weight: 4.0 ± 0.3 mg/g body weight; collagen density: 2.21 ± 0.16%), which were all prevented with irbesartan (2.3 ± 0.1, 1.30 ± 0.13, p < 0.001), but not with BMS-182874 (4.0 ± 0.2, 2.41 ± 0.22). Bosentan also prevented fibrosis (1.39 ± 0.18) but not hypertension and LV hypertrophy (3.38 ± 0.27). Combined irbesartan and BMS-182874 treatment prevented LV hypertrophy (2.9 ± 0.1) but not fibrosis (2.52 ± 0.16). Collagen density correlated (r = 0.414, p < 0.05) with plasma aldosterone levels. In TGRen2 with LV hypertrophy, the gene expression of ANP and ETB but not that of TGFß1 and procollagen 1(I) was increased.
CONCLUSIONS: In Ang IIdependent hypertension, cardiac fibrosis was associated with LV hypertrophy and was hindered by both mixed ETA/ETB blockade and AT-1 blockade. Only the latter treatment prevented both hypertension and LV hypertrophy. Thus, there is a dissociation between the mechanisms of cardiac fibrosis and hypertension, which do and do not entail ET-1, respectively.
|
Abbreviations and Acronyms
| | Ang II | | angiotensin II | | ANP | | atrial natriuretic peptide | | AT-1 | | angiotensin II type I receptor | | BP | | blood pressure | | BW | | body weight | | DOCA | | deoxycorticosterone acetate | | ET-1 | | endothelin-1 | | LV | | left ventricle | | RAAS | | renin-angiotensin-aldosterone system | | TGFß1 | | transforming growth factor-beta 1 | | TGRen2 | | transgenic (mRen2)27 rat | | 2K1C | | 2 kidney 1 clip model |
|
Cardiac fibrosis is a relevant clinical problem that will become even more important with the aging of the population and the increased survival of patients with different cardiac diseases. Compelling evidence indicates that excess collagen deposition detrimentally affects the functional properties of the heart by increasing diastolic stiffness, impairing systolic function, favoring arrhythmias, and ultimately leading to pump failure.
The renin-angiotensin-aldosterone system (RAAS) is deemed to play a pivotal role in regulating the deposition of extracellular matrix in the heart and causing cardiac fibrosis. In vitro experiments on fibroblasts initially showed that both angiotensin II (Ang II) and aldosterone concentration-dependently promoted collagen synthesis; in vivo studies in experimental models of hypertension with either an excess mineralocorticoid activity or an activated RAAS subsequently confirmed these findings (1,2).
The transgenic (mRen2)27 rat (TGRen2) features an overexpression of the Ren2 transgene in several tissues, with ensuing increased Ang II concentrations (3); accordingly, it is regarded as a paradigm of severe Ang IIdependent hypertension and cardiovascular disease. In the myocardium, the amount of Ren2 messenger ribonucleic acid (mRNA) correlates not only with the transgene dose (4) but also with the content of Ang II, which might act in a paracrine fashion to cause both cardiac hypertrophy and fibrosis. Thus, the high tissue Ang II levels in the myocardium might interact synergistically with the stress imposed by the high afterload in stimulating protein synthesis and cardiomyocyte and fibroblast growth (2). Because cardiac fibrosis was found to correlate with impaired diastolic function more closely than cardiac hypertrophy (5,6), it is likely to play a major role in impairing cardiac function.
In the adrenal cortex, expression of the Ren2 transgene and high tissue Ang II (7) lead to enhanced aldosterone secretion (8) that, along with Ang II (3,9), can enhance collagen synthesis, thus inducing a progressive collagen accumulation with aging (10). Nonetheless, it remains uncertain if and by which mechanisms cardiac fibrosis occurs in TGRen2 (10,11).
The existence of interactions between the RAAS and endothelin (ET)-1 (12) suggests an involvement of the latter in cardiac fibrosis. Angiotensin II activates the transcription of the preproET-1 gene in different cell types of the heart, including myocytes, vascular smooth muscle, and endothelial cells (13). Thus, the high cardiac tissue Ang II content might increase locally the ET-1 synthesis. Endothelin-1 activates the procollagen I promoter (14) and collagen synthesis in fibroblasts; it can modulate collagenase activity, although it is unclear which ET receptor subtype mediates these effects (1518). Moreover, ET-1 potently stimulates, via ETB receptors, aldosterone release (19) and therefore might increase collagen synthesis via enhanced aldosterone secretion. Thus, we investigated the deposition of myocardial collagen and the gene expression of procollagen 1(I), ETB, transforming growth factor-beta 1 (TGFß1), endothelin converting enzyme (ECE), and atrial natriuretic peptide (ANP) in TGRen2, an obvious experimental model in which to test this hypothesis. We also assessed the effects of selective blockade of the angiotensin II type I receptor (AT-1), ETA, and ETB receptor subtypes on myocardial collagen deposition.
 |
Materials and methods
|
|---|
Male heterozygous TGRen2 at age four weeks, after measurement of body weight (BW) and systolic blood pressure (BP, tail-cuff method), were BW- and BP-matched and randomly allocated to receive for four weeks any of the following treatments: a placebo, the mixed ETA/ETB endothelin receptor antagonist bosentan (100 mg/kg BW), the AT-1 receptorselective antagonist irbesartan (50 mg/kg BW), the ETA-selective endothelin receptor antagonist BMS-182874 (52 mg/kg BW orally), and the combined treatment of irbesartan (50 mg/kg BW) plus BMS-182874 (52 mg/kg BW orally). These dosages of irbesartan and ET-1 receptor antagonists were chosen because they were previously shown to abolish the pressor effect of Ang II and ET-1, respectively (3). Bosentan was a generous gift of Dr. Martine Clozel (Actelion Ltd, Allschwil, Switzerland), and BMS-182874 and irbesartan were generously provided by Dr. James Powell of Bristol Myers Squibb (Princeton, New Jersey).
Each treatment was given individually to each rat as a chocolate-flavored agarose gel tablet. The latter was cut into pieces of proper size in order to obtain the amount required to provide each individual rat with its BW-tailored daily dosage of drug (3). The study protocol and animal handling followed our institutional guidelines for animal studies and were previously reported (20). At weekly intervals, we measured BW and systolic BP levels (by a tail-cuff method, as the mean value of at least three readings). When the rats were eight weeks old, they were weighed and euthanized by cervical dislocation. The hearts were quickly removed and weighed, then the left ventricle (LV) was rapidly dissected from atria and right ventricle, weighted, snap-frozen in isopentane precooled on dry ice, and stored in liquid nitrogen until analyzed. After removal of the heart and lungs, blood was collected into heparinized tubes for the measurement of plasma aldosterone, as reported (3).
Collagen density and types.
5-µm equatorial and serial sections obtained from the LV tissue were stained with Sirius red (0.5% Sirius red F3BA in saturated picric acid) to visualize fibrillar collagen. Quantitative analysis was performed blindly by a single examiner (T.M.S.), using a photomicroscope Leica DM equipped with QWin Standard Leica Image Software. To minimize operator-dependent variability, a specific routine was used to automatically detect chromatic tonalities corresponding to Sirius redstained collagen fibrils. Views were randomly selected from each section. Ten random views were captured and analyzed for each section at magnification x10, because a pilot study showed that they represented accurately the entire section. To estimate perivascular fibrosis, at least one vessel with external diameter between 50 and 150 µm was also included in 4 of the 10 views considered for each section. All these measurements were performed on at least four sections for each rat. We estimated collagen density by measuring in each field the percent of total surface area pertaining to fibrillar collagen, identified as specified earlier (21). This morphometric approach for measurement of fibrillar collagen within the cardiac interstitium was previously validated (22); collagen density assessed by this technique was also shown to correlate with hydroxyproline concentration in the LV (23,24).
For measurements of the media cross-sectional areas of the cardiac arterioles, sections of four to six arterioles (ranging between 50 and 250 µm in diameter) for each rat were cut across their transverse axis and examined at x20 magnification. The aforementioned software was used to automatically compute all direct measurements.
Polarization microscopy was used to measure strongly (red-orange) and weakly (greenish-yellow) birefringent fibers in picrosirius-stained sections (25). These fibers roughly correspond to collagen type I, 1.6 to 2.4 µm diameter-thick, and collagen type III, less than 0.8 µm diameter-thick fibers, respectively (26). Specific routines were created with the QWin Standard Leica Image Software and were used to measure total and red-orange or greenish-yellow birefringent areas. The latter were expressed as percent of the total area examined in each section, as described previously.
Immunohistochemistry to laminin
Serial sections obtained from the LV tissue were also immunostained with a mouse anti-laminin monoclonal antibody (MAB 1920, Chemicon International, Temecula, California) in a Ventana Full Nexes IHC Unit (Ventana, Strasbourg, France) using biotin-streptavidin-conjugated AffiniPure donkey antimouse immunoglobulin G (Jackson ImmunoResearch, ListarFish, Carugate, Italy). The extent of immunostaining was scored blindly from 1 to 4 by two independent observers.
Gene expression studies
Total RNA was extracted according to the Trizol protocol (Gibco-Life Technology, Grand Island, New York). Gene expression for ETB, TGFß1, ECE, and ANP was assessed by Northern blot analysis, as described (27). These experiments were carried out in the Department of Pharmacology and Toxicology of the Freie University of Berlin.
Gene expression for procollagen 1(I) was measured by real-time fluorescence reverse transcriptase/polymerase chain reaction. Primers for this gene (Access code: Z78279) were selected with Primer3 software: Forward: GGCAACAAAGGAGACACTG, Reverse: CAACACCATCAGCACCAG. The housekeeping gene GAPDH (Access code: AF106860
[GenBank]
) was amplified in parallel with the following primers: Forward: CCCTTCATTGACCTCAACTA, Reverse: GCCAGTGAGCTTCCCGTTCA and used for normalization purposes. Quantification of mRNA levels was carried out using a thermal cycler (iCycler, Biorad, Milan, Italy) equipped with an online fluorescence-based detection system of amplification products. Melting curve analysis was used to confirm the specificity of the amplification products.
Statistical analysis
Results are expressed as mean ± SEM. Comparisons of active treatments with placebo were performed with non-parametric Mann-Whitney U test. Plasma aldosterone was analyzed after log transformation. To investigate the relationship between collagen density and plasma aldosterone or total birefringence, and between plasma aldosterone and selective red-orange or greenish-yellow birefringence, we used Pearson correlation coefficient and a stepwise regression analysis (backward method with an inclusion cutoff value of 0.05). A p value <0.05 was considered statistically significant. Analyses were carried out with the SPSS for Windows statistical package (version 10.0, SPSS Inc., Chicago, Illinois).
 |
Results
|
|---|
BP, heart weight, and plasma aldosterone levels.
No significant differences of BP at baseline and of BW at any time during the study period between experimental groups were observed. Starting from the end of the first week of treatment, the rats on irbesartan showed a markedly lower BP (p < 0.001) compared with the other groups (Fig. 1). At variance, in the group receiving irbesartan plus BMS-182874, lower BP values (p < 0.01) were recorded only at the end of the third week compared with the bosentan and BMS-182874 groups.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 1 Systolic blood pressure (SBP) values in the five experimental groups before and during the treatment with placebo (open squares), bosentan (closed circles), irbesartan (closed down triangles), BMS-182874 (open triangles), and irbesartan plus BMS-182874 (closed up triangles). Starting from the end of the first week of treatment, SBP was significantly lower (p < 0.001) in the irbesartan group compared with all other groups. In the irbesartan plus BMS-182874 group, SBP was significantly (p < 0.01) lower only at the end of the third week compared with the bosentan and BMS-182874 groups.
|
|
At the end of the study period, a significantly lower weight of the LV was observed in the groups treated with irbesartan compared with the other groups, with the exception of irbesartan plus BMS-182874. In the latter group, the LV weight was lower than in the placebo and BMS-182874 groups (Table 1). The lowest weight of the LV and the heart in toto was seen in the irbesartan and the highest in the BMS-182874 group; no significant differences of the right ventricle weight were found between groups (data not shown). Plasma aldosterone levels were significantly decreased only by irbesartan (Table 1).
View this table:
[in this window]
[in a new window]
|
Table 1 LV Weight, Plasma Aldosterone Levels, Media Cross-Sectional Area of Arterioles, Results of Gene Expression Experiments, and Immunostaining to Laminin in the LV Tissue of the Five Experimental Groups
|
|
Left ventricular collagen.
No area of scarring was detected in the examined fields. Significant differences in collagen density were found between groups (Fig. 2). Both irbesartan and bosentan significantly reduced collagen density by 42% and 37%, respectively. Conversely, both BMS-182874 and irbesartan plus BMS-182874 significantly increased collagen density compared with either bosentan or irbesartan (Fig. 3). Similar differences between treatment groups were seen in perivascular fibrosis (Fig. 2). Collagen density significantly correlated with plasma aldosterone levels (r = 0.414, p < 0.05).

View larger version (157K):
[in this window]
[in a new window]
|
Figure 2 Microphotographs of left ventricular myocardium stained with the collagen-specific dye Sirius red. Collagen fibers appear as red structures, and myocytes and intramyocardial vessels are yellow (magnification x40). A diffuse interstitial and a marked perivascular fibrosis is evident in placebo-treated eight-week-old TGRen2 (A). Irbesartan (B) and bosentan (C) treatment for four weeks resulted in a marked reduction of fibrosis, both in the interstitium and perivascularly. No effect of treatment with the ETA receptor antagonist BMS-182874 (D) was seen. The combined treatment with irbesartan plus BMS-182874 (E) did not reduce cardiac fibrosis compared with placebo and with BMS-182874 alone.
|
|

View larger version (37K):
[in this window]
[in a new window]
|
Figure 3 Left ventricular collagen density, expressed as percent of the total area pertaining to fibrillar collagen (as visualized by the Sirius red staining) and measured by videodensitometry, was significantly decreased in bosentan- and irbesartan-treated eight-week-old TGRen2 compared with both age- and gender-matched placebo-treated TGRen2 and with BMS-182874 or BMS-182874 + irbesartan. The BMS-182874, either alone or combined with irbesartan, did not reduce collagen density compared with placebo.
|
|
Polarization microscopy showed differences of total birefringence that strikingly mirrored those of collagen density (Fig. 4); the lowest values being found in the bosentan and irbesartan groups, and the highest in the irbesartan plus BMS182874 group. Red-orange fibers showed changes that paralleled those of collagen density and total birefringence, whereas greenish-yellow fibers exhibited an opposite behavior (Fig. 4). A correlation was found between total birefringence and collagen density (r = 0.61, p < 0.01). Plasma aldosterone levels correlated (p < 0.05) with red-orange directly (r = 0.38) and with greenish-yellow birefringence inversely (r = 0.382).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 4 The bar graph shows total birefringence (left bars of each group) and the ratio of red-orange to greenish-yellow fibers (right bars of each group) of Sirius redstained sections of the LV of eight-week-old TGRen2, assessed with polarization microscopy. Total birefringence is expressed as percent of the total area pertaining to the sum of red-orange and greenish-yellow fibers, which roughly correspond to collagen type I and III, respectively. Total birefringence and the ratio of red-orange to greenish-yellow fibers were lower in bosentan-treated TGRen2 compared with placebo. The TGRen2 receiving irbesartan + BMS-182874 showed a significantly higher total birefringence compared with both bosentan- and irbesartan-treated TGRen2.
|
|
The media cross-sectional area of the intracardiac arterioles was significantly lower in irbesartan-treated than in BMS-182874-treated TGRen2.
Immunostaining to laminin
The immunostaining to laminin was located in the plasma membranes of cardiomyocytes and in the subendothelial lining. Results of the semiquantitative assessment showed no discernible differences between experimental groups (Table 1).
Gene expression studies
Results of Northern blots are summarized in Table 1. The ETB exhibited a significant decrease with irbesartan compared with BMS-182874. No significant difference between groups was observed for mRNA levels of ANP, TGFß1, ECE, and procollagen 1(I).
 |
Discussion
|
|---|
One of the major findings of this study, which resolves the existing controversies (10,11,2729), is the demonstration that cardiac fibrosis occurred early (Fig. 1) and was associated with prominent LV hypertrophy in this model of severe Ang IIdependent hypertension. The finding of an exclusive increase of LV mass is fully consistent with available results in 10- to 14-week-old TGRen2 (10,11), whereas that of an early developing cardiac fibrosis involving both the interstitium and the perivascular regions is not. In 10-week-old TGRen2, Bishop et al. also found cardiac fibrosis; in contrast, Flesch et al., on the basis of measurements of hydroxyproline content and a qualitative evaluation of LV sections exposed to trichrome staining for connective tissue, found no cardiac fibrosis (10,11). It is always difficult to reconcile divergent results of studies carried out with different methodologies; however, it is worth pointing out that the measurement of hydroxyproline is a rather insensitive tool for the assessment of early cardiac fibrosis because this amino acid residue entails only a minor proportion (about 14%) of collagen. This is shown by the histologic finding of cardiac fibrosis despite no increase of hydroxyproline content in the LV of young TGRen2 (10). Furthermore, in our experience the trichrome staining techniques, which were used in previous studies (10,11) for visualizing connective tissue, provide quite variable results and therefore are unsuitable for quantitation purposes. This is at variance with the Sirius red staining of fibrillar collagen, which provides accurate and consistent results.
Our findings, with a painstaking operator-independent quantitative evaluation of collagen density on serial sections of the LV, fully support the conclusion that fibrillar collagen deposition occurs at an early stage of cardiac hypertrophy in the LV of TGRen2 (27).
Polarization microscopy evaluation of the sections demonstrated that Sirius redstained fibrillar collagen mostly represents collagen types I and III, as indicated by the close correlation between collagen density and total birefringence in each section. Furthermore, accumulation of fibrillar collagen was largely accounted for by thick, strongly birefringent red-orange fibers that correspond to a large extent to collagen type I. In contrast, thin, weakly birefringent greenish fibers, mostly entailing collagen type III, were predominantly found in those hearts that did not show overt cardiac fibrosis, such as those of the irbesartan and bosentan groups. The relative abundance of these types of fibers and collagens might be of utmost importance in determining the diastolic properties of the heart. Of note, we did not find any differences in the amount of immunostaining to laminin between our experimental groups, suggesting that changes of this basement membrane protein do not play a major role in cardiac fibrosis.
Mechanisms of cardiac fibrosis.
We used a combined strategy based on gene expression experiments and on pharmacologic intervention with drugs capable of providing specific blockade of the AT-1 or of the ETA and ETB receptors to gain information on their potential involvement and on the mechanisms underlying cardiac fibrosis. Our gene expression experiments showed an increased expression of ANP mRNA and a significant correlation between ANP mRNA and LV mass index, which accord well with previous findings (11,21), as well as with the contention that this gene is a marker of cardiac hypertrophy. We also found an increase of ETB mRNA in the groups with overt LV hypertrophy (Table 1). The ETB mRNA correlated significantly with the media cross-sectional area of the intracardiac arterioles (r = 0.636, p = 0.001) and with LV mass index. Accordingly, an increased ETB gene expression, which might therefore be due to an increase in vascular endothelial cells, could also be a marker of cardiac hypertrophy. The expression of the TGFß1 gene was previously found to occur with the development of cardiac hypertrophy, but only early and transiently (21,30). Hence, it is not surprising that its expression was not found to be enhanced under the chronic conditions of this study. The expression of procollagen 1(I) did not reflect the marked differences in collagen density that were seen between groups. Thus, it might be that the early activation of Ang II production due to the transgene expression from birth and the ensuing recruitment of the ET-1 system stimulate collagen synthesis only early on and that a blunted collagen-degrading activity may account for extracellular matrix deposition later on. We could not measure the activity of enzymes involved in collagen degradation, therefore this hypothesis remains to be conclusively proven.
We found that the AT-1 receptor antagonist irbesartan prevented both hypertension and cardiac hypertrophy. It has recently been contended that pressure overload is the only factor responsible for development of LV hypertrophy and cardiac fibrosis in TGRen2 (10). This proposal has been contradicted by a reevaluation of the data obtained with amlodipine in the same study (31) and is not supported by the present results with the different receptor antagonists. Our regression analysis showed that plasma aldosterone, besides BP levels, significantly predicted collagen density, thus supporting the view that there are multiple determinants of cardiac fibrosis. This conclusion agrees also with findings in another model of hypertension caused by inhibition of nitric oxide synthesis, where bosentan prevented the severity of glomerular and interstitial fibrosis in the kidney (14), even despite that there was no effect on the development of hypertension (32).
ET-1 and cardiac fibrosis
The role of ET-1 in Ang IIdependent hypertension remains unclear because there are studies implicating ET-1 in models of Ang II infusion (33,34) and others contradicting this contention in models with enhanced synthesis of endogenous Ang II, such as the 2 kidney 1 clip (2K1C) and the TGRen2 models (3,12). Nonetheless, in these latter conditions, as well as in post-myocardial infarction models of congestive heart failure (35), the ET system would appear to play a role in the progression of cardiovascular damage, including cardiac fibrosis and LV dysfunction (27). This detrimental role of ET-1 is deemed to be even more important in models with excess mineralocorticoid activity, where the vascular synthesis of ET-1 is enhanced (1). In deoxycorticosterone acetate (DOCA)salt hypertensive rats, an ETA-selective antagonist prevented cardiac fibrosis and activation of procollagen 1(I) synthesis (21), thus implicating the ETA receptor subtype. Experiments in 2K1C rat with the ETA antagonist BQ-123 and with the ETB antagonist IRL-1038 led to the hypothesis that the ETB subtype might mediate cardiac fibrosis when the RAAS is activated (36). However, the implication of the ETB receptor in cardiac fibrosis remained to be conclusively demonstrated (37), because IRL-1038 was publicly retreated because of its inconsistent selectivity for the ETB receptor by those who synthesized it (38).
The present findings of prevention of cardiac fibrosis with the mixed ETA/ETB antagonist bosentan, but not with the ETA-selective antagonist BMS-182874, are consistent with previous findings in chronic heart failure (35) and point to the ETB as mediator of cardiac fibrosis in TGRen2. A role of ETB receptors in collagen deposition was previously shown in the liver (15,18). In addition, in chronic heart failure ETB blockade reduced cardiac fibrosis despite the lack of hemodynamic effects (18,39). The present findings in TGRen2 are consistent with this observation and shed new light on the role of this receptor subtype in cardiac fibrosis.
It must be acknowledged that our pharmacologic experiments provided evidence for a role of ETB receptors in cardiac fibrosis by "subtraction," i.e., by comparison of a mixed ETA/ETB with an ETA-selective antagonist. However, this is due to the current unavailability of an ETB-selective antagonist for chronic in vivo studies. Furthermore, our findings of an increased expression of the ETB gene in the heart of TGRen2 treated with the ETA-selective antagonist that exhibited marked cardiac fibrosis, compared with all other groups (Table 1), are consistent with a role of ETB receptors in cardiac fibrosis.
ETB receptor subtype, cardiac fibrosis, and aldosterone synthesis
Based on the fact that the correlation between cardiac ETB receptor gene expression and collagen density was weak and not significant, we would like to suggest, however, an alternative explanation, which does not postulate changes of ETB receptors in the heart. Endothelin-1 acts as a potent secretagogue of aldosterone via ETB receptors (19,40), and compelling evidence implicates both aldosterone and Ang II in cardiac fibrosis (2). Thus, it might be that the major mechanism leading to cardiac fibrosis entails an Ang II- and ET-1-driven stimulation of aldosterone secretion. The beneficial effect of bosentan and the lack of effect of BMS-182874 could be explained on this ground. The predominant perivascular distribution of cardiac fibrosis and the significant correlation between collagen density and plasma aldosterone levels (Fig. 2) also support a major role of blood-borne aldosterone. This contention might also reconcile the present results with those obtained with A-127722, an ETA-selective antagonist that lowered BP and prevented cardiac fibrosis in DOCAsalt hypertensive rats (21). In this latter model, the secretagogue effect of ET-1 on aldosterone is likely to be negligible because of the concomitant suppression of the RAAS induced by the exogenously administered salt and DOCA. In addition, the lowering of BP seen with A-127722 made it difficult to attribute the prevention of cardiac fibrosis only to ETA. We hypothesize that the relative importance of ETA and ETB receptors in causing cardiac fibrosis could markedly differ between experimental models, depending on the prevailing degree of activation of the RAAS and on the concomitant changes in BP. Thus, development of cardiac fibrosis in TGRen2 is likely to derive from a synergistic interaction of the RAAS and ET system. Results in another double transgenic model of severe hypertension and cardiac hypertrophy characterized by activation of RAAS support this view (41). The clinical implications of these findings for the prevention or progression of cardiac fibrosis with ET antagonists in patients with congestive heart failure, who might have an activated RAAS, are obvious.
In conclusion, the AT-1-selective antagonist irbesartan prevented hypertension, cardiac hypertrophy, and cardiac fibrosis in TGRen2. The mixed ETA/ETB antagonist bosentan, but not an ETA-selective antagonist, also hindered cardiac fibrosis despite having no effect on BP and cardiac hypertrophy. Both irbesartan and bosentan corrected the secondary hyperaldosteronism; furthermore, plasma aldosterone levels correlated significantly with collagen density in the LV myocardium. Thus, collectively these results indicate that although cardiac hypertrophy and cardiac fibrosis go hand in hand, the mechanisms regulating the two processes differ and could be differentially modulated pharmacologically.
 |
Footnotes
|
|---|
This study was partly supported by a research grant of the University of Padua to Dr. Rossi. Dr. Seccia was supported by the "G. Muiesan Fellowship" of the Italian Society of Arterial Hypertension.
 |
References
|
|---|
1. Schiffrin EL. Endothelin: potential role in hypertension. J Cardiovasc Pharmacol. 2000;35:3335
2. Brilla CG, Maisch B, Zhou G, Weber KT. Hormonal regulation of cardiac fibroblast function. Eur Heart J. 1995;16(Suppl C):4550[CrossRef][Medline]
3. Rossi GP, Sacchetto A, Rizzoni D, et al. Blockade of angiotensin II type 1 receptor and not of endothelin receptor prevents hypertension and cardiovascular disease in transgenic TGR(mRen2)27 rats via adrenocortical steroid-independent mechanisms. Arterioscl Thromb Vasc Biol. 2000;20:949956[Abstract/Free Full Text]
4. Lee MA, Bohm M, Kim S, et al. Differential gene expression of renin and angiotensinogen in the TGR(mREN-2)27 transgenic rat. Hypertension. 1995;25:570580[Abstract/Free Full Text]
5. Brilla CG, Janicki JS, Weber KT. Impaired diastolic function and coronary reserve in genetic hypertension: role of interstitial fibrosis and medial thickening of intramyocardial coronary arteries. Circ Res. 1991;69:107115[Abstract/Free Full Text]
6. Kim HE, Dalal SS, Young E, Legato MJ, Weisfeldt ML, DArmiento J. Disruption of the myocardial extracellular matrix leads to cardiac dysfunction. J Clin Invest. 2000;106:857866[Medline]
7. Sander M, Bader M, Djavidani B, et al. The role of the adrenal gland in hypertensive transgenic rat TGR(mREN2)27. Endocrinology. 1992;131:807814[Abstract/Free Full Text]
8. Mullins JJ, Peters J, Ganten D. Fulminant hypertension in transgenic rats harbouring the mouse Ren-2 gene. Nature. 1990;344:541544[CrossRef][Medline]
9. Flesch M, Schiffer F, Zolk O, et al. Contractile systolic and diastolic dysfunction in renin-induced hypertensive cardiomyopathy. Hypertension. 1997;30:383391[Abstract/Free Full Text]
10. Bishop JE, Kiernan LA, Montgomery HE, Gohlke P, McEwan JR. Raised blood pressure, not renin-angiotensin systems, causes cardiac fibrosis in TGR m(Ren2)27 rats. Cardiovasc Res. 2000;47:5767[Abstract/Free Full Text]
11. Flesch M, Schiffer F, Zolk O, et al. Contractile systolic and diastolic dysfunction in renin-induced hypertensive cardiomyopathy. Hypertension. 1997;30:383391[Abstract/Free Full Text]
12. Rossi GP, Sacchetto A, Cesari M, Pessina AC. Interactions between endothelin-1 and the renin-angiotensin-aldosterone system. Cardiovasc Res. 1999;43:300307[Abstract/Free Full Text]
13. Hahn AW, Resink TJ, Scott Burden T, Powell J, Dohi Y, Buhler FR. Stimulation of endothelin mRNA and secretion in rat vascular smooth muscle cells: a novel autocrine function. Cell Regul. 1990;1:649659[Medline]
14. Chatziantoniou C, Boffa JJ, Ardaillou R, Dussaule JC. Nitric oxide inhibition induces early activation of type I collagen gene in renal resistance vessels and glomeruli in transgenic mice: role of endothelin. J Clin Invest. 1998;101:27802789[Medline]
15. Rockey DC, Chung JJ. Endothelin antagonism in experimental hepatic fibrosis. Implications for endothelin in the pathogenesis of wound healing. J Clin Invest. 1996;98:13811388[Medline]
16. Guarda E, Katwa LC, Myers PR, Tyagi SC, Weber KT. Effects of endothelins on collagen turnover in cardiac fibroblasts. Cardiovasc Res. 1993;27:21302134[Abstract/Free Full Text]
17. Dawes KE, Cambrey AD, Campa JS, et al. Changes in collagen metabolism in response to endothelin-1: evidence for fibroblast heterogeneity. Int J Biochem Cell Biol. 1996;28:229238[CrossRef][Medline]
18. Gandhi CR, Kuddus RH, Uemura T, Rao AS. Endothelin stimulates transforming growth factor-beta1 and collagen synthesis in stellate cells from control but not cirrhotic rat liver. Eur J Pharmacol. 2000;406:311318[CrossRef][Medline]
19. Belloni A, Rossi GP, Andreis PG, et al. Endothelin adrenocortical secretagogue effect is mediated by the B receptor in rats. Hypertension. 1996;27:11531159[Abstract/Free Full Text]
20. Rossi GP, Cavallin M, Belloni AS, et al. Aortic smooth muscle cell phenotypic modulation and fibrillar collagen deposition in angiotensin II-dependent hypertension. Cardiovasc Res. 2002;55:178179[Abstract/Free Full Text]
21. Ammarguellat F, Larouche II, Schiffrin EL. Myocardial fibrosis in DOCA-salt hypertensive rats : effect of endothelin ET(A) receptor antagonism. Circulation. 2001;103:319324[Abstract/Free Full Text]
22. Brilla CG, Matsubara L, Weber KT. Advanced hypertensive heart disease in spontaneously hypertensive rats: lisinopril-mediated regression of myocardial fibrosis. Hypertension. 1996;28:269275[Abstract/Free Full Text]
23. Weber KT, Janicki JS, Shroff SG, Pick R, Chen RM, Bashey RI. Collagen remodeling of the pressure-overloaded, hypertrophied nonhuman primate myocardium. Circ Res. 1988;62:757765[Abstract/Free Full Text]
24. Pickering JG, Boughner DR. Fibrosis in the transplanted heart and its relation to donor ischemic time: assessment with polarized light microscopy and digital image analysis. Circulation. 1990;81:949958[Abstract/Free Full Text]
25. Junqueira LC, Bignolas G, Brentani RR. Picrosirius staining plus polarization microscopy, a specific method for collagen detection in tissue sections. Histochem J. 1979;11:447455[CrossRef][Medline]
26. Dayan D, Hiss Y, Hirshberg A, Bubis JJ, Wolman M. Are the polarization colors of picrosirius red-stained collagen determined only by the diameter of the fibers? Histochemistry. 1989;93:2729[CrossRef][Medline]
27. Rothermund L, Pinto YM, Hocher B, et al. Cardiac endothelin system impairs left ventricular function in renin-dependent hypertension via decreased sarcoplasmic reticulum Ca2+ uptake. Circulation. 2000;102:15821588[Abstract/Free Full Text]
28. Bachmann S, Peters J, Engler E, Ganten D, Mullins J. Transgenic rats carrying the mouse renin genemorphological characterization of a low-renin hypertension model. Kidney Int. 1992;41:2436[Medline]
29. Villarreal FJ, MacKenna DA, Omens JH, Dillmann WH. Myocardial remodeling in hypertensive Ren-2 transgenic rats. Hypertension. 1995;25:98104[Abstract/Free Full Text]
30. Villarreal FJ, Dillmann WH. Cardiac hypertrophy-induced changes in mRNA levels for TGF-beta 1, fibronectin, and collagen. Am J Physiol. 1992;262:H18611866[Medline]
31. Brilla CG. Renin-angiotensin-aldosterone system and myocardial fibrosis. Cardiovasc Res. 2000;47:13[Free Full Text]
32. Tharaux PL, Chatziantoniou C, Casellas D, Fouassier L, Ardaillou R, Dussaule JC. Vascular endothelin-1 gene expression and synthesis and effect on renal type I collagen synthesis and nephroangiosclerosis during nitric oxide synthase inhibition in rats. Circulation. 1999;99:21852191[Abstract/Free Full Text]
33. Barton M, Shaw S, dUscio LV, Moreau P, Luscher TF. Angiotensin II increases vascular and renal endothelin-1 and functional endothelin converting enzyme activity in vivo: role of ETA receptors for endothelin regulation. Biochem Biophys Res Commun. 1997;238:861865[CrossRef][Medline]
34. Moreau P, dUscio LV, Shaw S, Takase H, Barton M, Luscher TF. Angiotensin II increases tissue endothelin and induces vascular hypertrophy: reversal by ET(A)-receptor antagonist. Circulation. 1997;96:15931597[Abstract/Free Full Text]
35. Mulder P, Richard V, Derumeaux G, et al. Role of endogenous endothelin in chronic heart failure: effect of long-term treatment with an endothelin antagonist on survival, hemodynamics, and cardiac remodeling. Circulation. 1997;96:19761982[Abstract/Free Full Text]
36. Hocher B, George I, Rebstock J, et al. Endothelin systemdependent cardiac remodeling in renovascular hypertension. Hypertension. 1999;33:816822[Abstract/Free Full Text]
37. Rossi GP, Cesari M, Pessina AC, Hocher B, George I. Endothelins and cardiac fibrosis. Hypertension. 1999;34:e1
38. Urade Y, Fujitani Y, Oda K, An endothelin B receptor-selective antagonist: IRL 1038, [Cys11- Cys15]-endothelin-1(11-21) [retraction of Urade Y, Fujitani Y, Oda K, In: FEBS Lett 1992 Oct 12;311(1):126]. FEBS Lett 1994;342:103
39. Mulder P, Boujedaini H, Richard V, et al. Selective endothelin-A versus combined endothelin-A/endothelin-B receptor blockade in rat chronic heart failure. Circulation. 2000;102:491493[Abstract/Free Full Text]
40. Nussdorfer GG, Rossi GP, Malendowicz LK, Mazzocchi G. Autocrine-paracrine endothelin system in the physiology and pathology of steroid-secreting tissues. Pharmacol Rev. 1999;51:135[Abstract/Free Full Text]
41. Bohlender J, Gerbaulet S, Kramer J, Gross M, Kirchengast M, Dietz R. Synergistic effects of AT(1) and ET(A) receptor blockade in a transgenic, angiotensin II-dependent, rat model. Hypertension. 2000;35:992997[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
V. G. DeMarco, M. S. Johnson, J. Habibi, L. Pulakat, R. Gul, M. R. Hayden, R. D. Tilmon, K. C. Dellsperger, N. Winer, A. T. Whaley-Connell, et al.
Comparative analysis of telmisartan and olmesartan on cardiac function in the transgenic (mRen2)27 rat
Am J Physiol Heart Circ Physiol,
January 1, 2011;
300(1):
H181 - H190.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Pavlopoulos and P. Nihoyannopoulos
Regional left ventricular distribution of abnormal segmental relaxation evaluated by strain echocardiography and the incremental value over annular diastolic velocities in hypertensive patients with normal global diastolic function
Eur Heart J Cardiovasc Imaging,
July 1, 2009;
10(5):
654 - 662.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Luther, Z. Wang, J. Ma, N. Makhanova, H.-S. Kim, and N. J. Brown
Endogenous Aldosterone Contributes to Acute Angiotensin II-Stimulated Plasminogen Activator Inhibitor-1 and Preproendothelin-1 Expression in Heart But Not Aorta
Endocrinology,
May 1, 2009;
150(5):
2229 - 2236.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Conen, U. B. Tedrow, B. A. Koplan, R. J. Glynn, J. E. Buring, and C. M. Albert
Influence of Systolic and Diastolic Blood Pressure on the Risk of Incident Atrial Fibrillation in Women
Circulation,
April 28, 2009;
119(16):
2146 - 2152.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Pavlopoulos, J. Grapsa, E. Stefanadi, V. Kamperidis, E. Philippou, D. Dawson, and P. Nihoyannopoulos
The evolution of diastolic dysfunction in the hypertensive disease
Eur Heart J Cardiovasc Imaging,
November 1, 2008;
9(6):
772 - 778.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. F. Opitz, R. Ewert, W. Kirch, and D. Pittrow
Inhibition of endothelin receptors in the treatment of pulmonary arterial hypertension: does selectivity matter?
Eur. Heart J.,
August 2, 2008;
29(16):
1936 - 1948.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Whaley-Connell, J. Habibi, S. A. Cooper, V. G. DeMarco, M. R. Hayden, C. S. Stump, D. Link, C. M. Ferrario, and J. R. Sowers
Effect of renin inhibition and AT1R blockade on myocardial remodeling in the transgenic Ren2 rat
Am J Physiol Endocrinol Metab,
July 1, 2008;
295(1):
E103 - E109.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. G. DeMarco, J. Habibi, A. T. Whaley-Connell, R. I. Schneider, R. L. Heller, J. P. Bosanquet, M. R. Hayden, K. Delcour, S. A. Cooper, B. T. Andresen, et al.
Oxidative stress contributes to pulmonary hypertension in the transgenic (mRen2)27 rat
Am J Physiol Heart Circ Physiol,
June 1, 2008;
294(6):
H2659 - H2668.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Wong, F. E. Brennan, M. J. Young, P. J. Fuller, and T. J. Cole
A Direct Effect of Aldosterone on Endothelin-1 Gene Expression in Vivo
Endocrinology,
April 1, 2007;
148(4):
1511 - 1517.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A. Gould, M. Yii, M. D. Esler, J. M. Power, and D. M. Kaye
Atrial fibrillation impairs cardiac sympathetic response to baroreceptor unloading in congestive heart failure
Eur. Heart J.,
December 1, 2005;
26(23):
2562 - 2567.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Thackaberry, Z. Jiang, C. D. Johnson, K. S. Ramos, and M. K. Walker
Toxicogenomic Profile of 2,3,7,8-Tetrachlorodibenzo-p-Dioxin in the Murine Fetal Heart: Modulation of Cell Cycle and Extracellular Matrix Genes
Toxicol. Sci.,
November 1, 2005;
88(1):
231 - 241.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Vaneckova, H. J. Kramer, A. Backer, Z. Vernerova, M. Opocensky, and L. Cervenka
Early Endothelin-A Receptor Blockade Decreases Blood Pressure and Ameliorates End-Organ Damage in Homozygous Ren-2 Rats
Hypertension,
October 1, 2005;
46(4):
969 - 974.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Milliez, X. Girerd, P.-F. Plouin, J. Blacher, M. E. Safar, and J.-J. Mourad
Evidence for an increased rate of cardiovascular events in patients with primary aldosteronism
J. Am. Coll. Cardiol.,
April 19, 2005;
45(8):
1243 - 1248.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. M. Pollock
Endothelin, Angiotensin, and Oxidative Stress in Hypertension
Hypertension,
April 1, 2005;
45(4):
477 - 480.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Tikellis, P. J. Wookey, R. Candido, S. Andrikopoulos, M. C. Thomas, and M. E. Cooper
Improved Islet Morphology after Blockade of the Renin- Angiotensin System in the ZDF Rat
Diabetes,
April 1, 2004;
53(4):
989 - 997.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. G Perez, M. C Villa-Abrille, E. A Aiello, R. A Dulce, H. E Cingolani, and M. C Camilion de Hurtado
A low dose of angiotensin II increases inotropism through activation of reverse Na+/Ca2+ exchange by endothelin release
Cardiovasc Res,
December 1, 2003;
60(3):
589 - 597.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T.-H. Cheng, P.-Y. Cheng, N.-L. Shih, I.-B. Chen, D. L. Wang, and J.-J. Chen
Involvement of reactive oxygen species in angiotensin II-induced endothelin-1 gene expression in rat cardiac fibroblasts
J. Am. Coll. Cardiol.,
November 19, 2003;
42(10):
1845 - 1854.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Pu, M. F. Neves, A. Virdis, R. M. Touyz, and E. L. Schiffrin
Endothelin Antagonism on Aldosterone-Induced Oxidative Stress and Vascular Remodeling
Hypertension,
July 1, 2003;
42(1):
49 - 55.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|