Advertisement






Click here for more guidelines.
CME Topic Collections Past Issues Search Current Issue Home
     

J Am Coll Cardiol, 2002; 39:2042-2048
© 2002 by the American College of Cardiology Foundation
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ackerman, M. J.
Right arrow Articles by Gersh, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ackerman, M. J.
Right arrow Articles by Gersh, B. J.

CLINICAL STUDY

Prevalence and age-dependence of malignant mutations in the beta-myosin heavy chain and troponin t genes in hypertrophic cardiomyopathy

A comprehensive outpatient perspective

Michael J. Ackerman, MD, PhD*{dagger}{ddagger},*, Sara L. VanDriest, BA{ddagger}, Steve R. Ommen, MD, FACC*, Melissa L. Will, BS*, Rick A. Nishimura, MD, FACC*, A. Jamil Tajik, MD, FACC* and Bernard J. Gersh, MB, ChB, DPhil, FACC*

* Department of Internal Medicine/Division of Cardiovascular DiseasesRochester, Minnesota, USA
{dagger} Pediatric and Adolescent Medicine/Division of Pediatric CardiologyRochester, Minnesota, USA
{ddagger} Molecular Pharmacology and Experimental Therapeutics, Mayo Clinic, Rochester, Minnesota, USA

Manuscript received June 14, 2001; revised manuscript received February 20, 2002, accepted April 1, 2002.

* Reprint requests and correspondence: Dr. Michael J. Ackerman, Pediatric Cardiology E9, Mayo Clinic, 200 First Street, Rochester, Minnesota 55905 USA.
ackerman.michael{at}mayo.edu


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 Conclusions
 References
 
OBJECTIVES: The goal of this study was to determine the prevalence of "malignant" mutations in hypertrophic cardiomyopathy (HCM).

BACKGROUND: Previous genotype-phenotype studies have implicated four mutations (R403Q, R453C, G716R and R719W) as highly malignant defects in the beta-myosin heavy chain (MYH7). In the cardiac troponin T gene (TNNT2), a specific mutation (R92W) has been associated with high risk of sudden death. Routine clinical screening for these malignant mutations has been suggested to identify high-risk individuals.

METHODS: We screened 293 unrelated individuals with HCM seen at the Mayo Clinic in Rochester, Minnesota, between April 1997 and October 2000. Deoxyribonucleic acid (DNA) was obtained after informed consent; amplification of MYH7 exons 13 (R403Q), 14 (R453C) and 19 (G716R and R719W), and TNNT2 exon 9 (R92W) was performed by polymerase chain reaction. The mutations were detected using denaturing high-performance liquid chromatography and automated DNA sequencing.

RESULTS: The mean age at diagnosis was 42 years with 53 patients diagnosed before age 25. The mean maximal left ventricular wall thickness was 21 mm. Nearly one-third of cases were familial and one-fourth had a family history of sudden cardiac death. Only 3 of the 293 patients possessed one of the five "malignant" mutations, and all 3 patients were <25 years of age at presentation (p < 0.006).

CONCLUSIONS: This finding underscores the profound genetic heterogeneity in HCM. Only 1% of unrelated individuals seen at a tertiary referral center for HCM possessed one of the five "malignant" mutations that were examined. Routine clinical testing for these specific mutations is of low yield.

Abbreviations and Acronyms
  DHPLC
  denaturing high-performance liquid chromatography
  DNA
  deoxyribonucleic acid
  HCM
  hypertrophic cardiomyopathy
  ICD
  implanted cardioverter defibrillator
  LVOTO
  left ventricular outflow tract obstruction
  LVWT
  left ventricular wall thickness
  MYH7
  cardiac beta-myosin heavy chain
  PCR
  polymerase chain reaction
  SCD
  sudden cardiac death
  TNNT2
  troponin T


Hypertrophic cardiomyopathy (HCM) is defined as the presence of a hypertrophied, nondilated left ventricle in the absence of another causative disease (1). It is estimated to affect 1 in 500 persons, with highly variable clinical and pathologic presentations and penetrance (2,3). The severity of disease varies from a lifelong asymptomatic course to a sentinel event of sudden cardiac death (SCD) at a young age. A growing realization that the implanted cardioverter defibrillator (ICD) is effective in the primary and secondary prevention of SCD has provided an added impetus to discover new approaches for the identification and risk stratification of susceptible individuals in whom the prophylactic implantation of an ICD might be life saving (4).

In addition to this phenotypic variability, there is profound heterogeneity in the genetic substrate for HCM. To date, nine genes encoding various components of the cardiac sarcomere have been implicated in HCM: cardiac beta-myosin heavy chain (MYH7) (5–8), troponin T (TNNT2) (9,10), alpha tropomyosin (TPM1), myosin binding protein C3 (MYBPC3), cardiac ventricular myosin light chain (MYL2), cardiac myosin alkali light chain (MYL3) (11), troponin I (TNNI3) (12), alpha cardiac actin (ACTC) (13,14) and titin (TTN) (15). The familial HCM mutation database lists over 150 unique mutations scattered throughout these sarcomeric genes (16).

Despite this considerable phenotypic and genotypic diversity, it was hoped that through genotype-phenotype correlative studies genetic testing would identify those individuals at high risk for SCD to facilitate primary prevention (17–19). Mutations in MYH7 are the most commonly described defects in HCM and account for approximately 35% to 50% of all cases of familial HCM (17,19–22). Although it is well-established that no particular clinical or prognostic phenotype is mutation specific, four MYH7 mutations, R403Q (exon 13), R453C (exon 14) and G716R and R719W (exon 19), have been associated particularly with a high incidence of SCD and are considered "malignant" mutations in comparison with other HCM-causing mutations (17,23,24). Mutations in cardiac troponin T, particularly R92W (exon 9), have been associated with a high incidence of SCD in spite of minimal hypertrophy (10,23).

The association between specific MYH7 and TNNT2 defects with an adverse prognosis raised the exciting possibility that genotyping alone may identify individuals at high risk of SCD and direct potentially lifesaving ICD therapy (19,21,25). The success of genotype-phenotype correlative studies is dependent on the interactions with modifier genes and environmental influences, but the notion that molecular genetic testing may direct clinical treatment persists (26,27). Moreover, from a cost-effective standpoint, an estimation of the prevalence of malignant mutations in the overall perspective of HCM is of utmost relevance. For these reasons, we determined the prevalence of these "malignant" mutations among a diverse, unselected group of patients with HCM seen in a subspecialty clinic within a large tertiary referral center.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 Conclusions
 References
 
Patient population.   From April 1997 through October 2000, 293 unrelated individuals seen in the Mayo Medical Center HCM Clinic and diagnosed with HCM provided written informed consent for genomic evaluation in this study approved by the Mayo Foundation Institution Review Board.

Extraction and amplification of MYH7 and TNNT2.
Genomic deoxyribonucleic acid (DNA) was extracted from peripheral blood lymphocytes using the Purgene DNA extraction kit from Gentra, Inc. (Minneapolis, Minnesota). Protein-encoding exons containing the previously reported "malignant" mutations (exons 13, 14 and 19) of the cardiac beta-myosin heavy chain, MYH7, were amplified from genomic DNA by polymerase chain reaction (PCR) using the full-length genomic sequence and previously published intron/exon-based primers (28). Exon 9 of cardiac troponin T, TNNT2, was amplified using a forward primer designed in our lab (5" CTAGCCCACCCATCTCTCC 3") and the published 9R280 reverse primer sequence (5" GGATGAGACAGACTGGCCATCAG 3") (29).

Mutational analysis
Sequence variations were detected by denaturing high-performance liquid chromatography (DHPLC) using the Transgenomic WAVE system (Omaha, Nebraska), as previously described (30). In brief, PCR products were injected into the denaturing column and eluted with increasing concentrations of acetonitrile. Homozygotes have only homoduplex DNA. Heterozygotes form both homoduplexes and heteroduplexes. Heteroduplexes are eluted from the column and detected before homoduplexes. Most sequence variations yield a unique elution profile and a characteristic chromatogram pattern. The precise nature of the sequence variation was determined by manual, radiolabeled ThermoSequenase sequencing (Amersham Life Science, Cleveland, Ohio) and independently confirmed by dye-terminator cycle-sequencing (ABI Prism 377) (31).

Mutations are denoted using accepted nomenclature (32). For proteins, the single letter amino acid code is utilized. To indicate an amino acid missense mutation, the format R403Q is used. Here, the "wild-type" amino acid (R = arginine) is given before and the mutant amino acid (Q = glutamine) is provided after the codon number , 403.

R403Q mutation-specific DdeI restriction enzyme assay.
DdeI restriction enzyme digests were performed to screen for the R403Q mutation in MYH7. Restriction digests were performed on PCR products for 2 h at 37°C, and then the digests were analyzed on a 3% agarose gel.

Statistical analysis
Tests for associations between the presence or absence of malignant mutations and clinical variables (i.e., gender, age-dependence, left ventricular wall thickness [LVWT]) were performed with Fisher exact test for categorical variables and the Wilcoxon-Mann-Whitney test for continuous and ordered variables. Reported p values are two-sided, and a p value <0.05 is considered statistically significant.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 Conclusions
 References
 
Table 1 summarizes the demographics of this HCM cohort. Between April 1997 and October 2000, 293 unrelated individuals diagnosed with HCM were seen at the HCM Clinic and investigated for the presence of a "malignant" mutation. Over half of the patients sought medical evaluation because of the presence of cardiac symptoms including angina, syncope, dyspnea or out-of-hospital cardiac arrest (n = 160, 54.6%). The remaining patients were diagnosed during evaluation of a family history of HCM, SCD or during a routine medical evaluation. A positive family history for HCM was elicited in 95 patients (32.4%). A total of 69 patients (23.5%) had a family history of at least one SCD before the age of 40. Overall, 40 patients (13.7%) presented with cardiac symptoms and a positive family history of SCD. The average age at diagnosis was 42.5 years. A total of 53 patients (18%) were diagnosed with HCM before age 25.


View this table:
[in this window]
[in a new window]
 
Table 1 Demographics of HCM Cohort (n = 293)

 
Figure 1 displays the anatomic phenotype of HCM expressed in this cohort. A total of 155 patients (53%) had "typical" HCM characterized by asymmetric septal hypertrophy and resting left ventricular outflow tract obstruction (LVOTO). In this subset with resting obstruction, the peak gradient at rest was approximately 60 mm Hg. For the entire cohort, the average maximal LVWT was 21 mm. The greatest LVWT recorded was 46 mm. A total of 18 patients (6.1%) had extreme hypertrophy (LVWT >30 mm). With respect to therapies rendered, 83 patients (28.3%) had a surgical myectomy, and 25 patients (8.5%) had received an ICD.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1 Morphology of hypertrophic cardiomyopathy (HCM). Anatomical phenotype of HCM seen in this cohort is depicted. A total of 155 of the patients (53%) had HCM characterized by asymmetric septal hypertrophy and left ventricular outflow tract obstruction (LVOTO). Apical = no gradient and hypertrophy predominantly in the distal one-third of the left ventricle (LV); HCM with LVOTO = resting gradient >50 mm Hg; Mid-cavitary obstruction = dynamic obstruction at the level of papillary muscle head or deeper within the LV cavity; Labile = resting gradient <50 mm Hg but provokable to >50 mm Hg with either Valsalva maneuver or amyl nitrite; Non-obstructive = no obstruction present at rest or with provocation.

 
Malignant mutations.   Only 3 of 293 patients (1%) were found to possess one of the previously published "malignant" mutations (Fig. 2A to 2C). All three individuals harboring a malignant mutation were diagnosed with HCM before age 25 (3/53 vs. 0/240, p < 0.006). Table 2 summarizes the clinical profiles of the three patients found to possess a "malignant" mutation.




View larger version (46K):
[in this window]
[in a new window]
 
Figure 2 "Malignant" mutation detection by denaturing high-performance liquid chromatography. Depicted are the elution profiles for normal samples and the "malignant" mutations identified in exon 14 (A), exon 19 (B) of the cardiac beta-myosin heavy chain (MHY7) gene and exon 9 (C) of the troponin T (TNNT2) gene.

 

View this table:
[in this window]
[in a new window]
 
Table 2 Patient Profiles

 
None of the 293 patients had the R403Q mutation by DHPLC. The absence of this specific mutation in this HCM cohort was confirmed using a mutation-specific restriction enzyme assay (data not shown). No patients were identified with the R719W mutation either. However, one patient had a published R719Q mutation indicating that DHPLC can resolve sequence variations at this site (data not shown).

Case 1
The R453C-MHY7 defect was found in an 11-year-old male patient despite no family history of HCM or sudden death (Fig. 2A). He was diagnosed during infancy after evaluation of a murmur. Calcium channel and beta-blocker therapy was initiated at age 8 after serial observation of increasing LVWT. He had extreme hypertrophy (38-mm septum) with maximal obstruction extending 4 cm below the aortic valve. At 11 years of age, a surgical myectomy was attempted, but the gradient was not eliminated completely. Two months later, he had a documented episode of symptomatic ventricular tachycardia. He was re-evaluated, and ventricular tachycardia was induced during an electrophysiology study. An ICD was implanted in March 2000. Thus far, there have been no shocks delivered.

Case 2
The G716R-MYH7 defect was found in a 32-year-old man with a strong family history of both HCM and SCD (Fig. 2B). He was known to have a murmur in childhood and was diagnosed with obstructive HCM in his early 20s after presenting with palpitations. He has never had a syncopal episode. Of his 10 siblings, 4 have echocardiographic documentation of obstructive HCM with asymmetric septal hypertrophy. There have been three sudden deaths in his immediate family including his mother at age 46 and two sisters—ages 16 and 42. His echocardiogram demonstrates a resting gradient of 77 mm Hg and severe septal hypertrophy with a maximal LVWT of 26 mm. He is now on beta-blockers and has received an ICD as primary prevention.

Case 3
A third patient possessed the R92W-TNNT2 mutation (Fig. 2C). This 24-year-old woman was diagnosed at 20 years of age after experiencing palpitations and mild dyspnea with exercise. Despite her TNNT2 substrate, she has echocardiographic evidence of extreme hypertrophy involving the entire septum but without any obstruction (LVWT = 33 mm). There is no family history of SCD. Her mother was diagnosed clinically with a "mild variant of HCM" based upon her echocardiogram at age 56. She has the R92W mutation as well. In contrast to her daughter, the hypertrophy was mild (16 mm), nonobstructive and localized to the midseptal region.


    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 Conclusions
 References
 
Genetic heterogeneity in HCM.   Hypertrophic cardiomyopathy is the final common pathway of several different sarcomeric defects. To date, over 150 mutations have been reported in nine different genes encoding various elements of the sarcomere. Mutations are scattered throughout these genes. Unlike diseases like cystic fibrosis where a single mutation (F508del) within a single gene (CFTR) causes the majority of cases, an HCM "hot-spot" does not exist (33). It would appear that new mutations are being discovered continually in the nine known HCM-causing genes, and it is likely that for many families with HCM the specific disease-causing mutation will be a unique one. In this respect, our own exon-targeted screening of MYH7 and TNNT2 revealed four novel mutations (unpublished data, M. J. Ackerman, January 2001). These factors will limit the widespread application of a future HCM gene chip containing only those mutations already identified. In addition to the complexities introduced by genotype-specific interactions with environmental influences and gene modifiers, significant technological challenges must be surmounted before routine HCM genotyping using gene chips becomes a clinical reality.

Malignant versus benign mutations
There is continued debate over the prognostic significance of HCM causing mutations. For every genotype-phenotype association there are exceptions, and these constitute a major impediment to the use of genotyping alone as a clinical and prognostic tool for the individual patient. Initially, the four mutations in MYH7 were assigned the malignant phenotype based on studies involving a limited number of families: five families with R403Q, one family with R453C, one family with G716R and four families with R719W (17,19,20,23,24). Several exceptions to these associations have been found. Marian et al. (21) reported a R403Q family where some affected members had only mild symptoms of HCM. Another R403Q Korean kindred has been reported having no SCD in the family (34). The G716R mutation has been reported in another small family with no history of SCD (17). The R92W-TNNT2 mutation is associated with minimal hypertrophy and high risk of SCD (10). However, in our study, the R92W-TNNT2 proband had extreme hypertrophy while her similarly affected mother did not, and there have been no sudden deaths in the family. Other confounding factors include the variability and phenotypic expression within individual families, the small size of many family studies, modifier genes, the role of polymorphisms and other nongenetic factors. Taken together, these observations weaken the premise that risk for SCD can be associated with any certain mutation. We do not yet have the understanding of HCM necessary to determine which mutation, combinations of mutations or combinations of mutations and environmental factors portend an ominous clinical outcome.

In this study, 1% of the HCM patients possessed one of the more frequently described "malignant" mutations involving the MYH7 and TNNT2 genes. Interestingly, only age predicted the presence of one of these "malignant" mutations. Three of 53 patients <25 years (5.7%) had 1 of 5 "malignant" mutations compared with none of the 240 patients over 25 years. No other factors including degree of hypertrophy, family history of HCM or sudden death were associated with this small subset of patients. Of the 40 patients presenting with cardiac symptoms and a family history of SCD, 1 had a malignant mutation (Case 2). Of the 18 patients manifesting extreme left ventricular hypertrophy (>30 mm), malignant mutations were identified in 2 patients. Moreover, the individual with the most significant number of sudden deaths (4) in the family did not have any of the five mutations analyzed for in this series. Given the profound genetic heterogeneity of HCM, the variability of clinical presentation, despite the same mutation profile, and the exceedingly low prevalence of "malignant" mutations in a high-risk tertiary center for HCM, genetic screening is not an appropriate test for risk assessment.

Study limitations
The proportion of patients in this cohort with obstructive HCM (53%) is higher than previously reported in population-based studies. This discrepancy likely stems from our institution’s experience in surgical myectomy/myotomy and referral patterns for surgical treatment of LVOTO. Previous reports of TNNT2 mutations indicate a phenotype of minimal hypertrophy (35). Therefore, TNNT2 mutations may be under-represented in our cohort.

This study was designed as an antemortem study to determine the frequency of "malignant" mutations in individuals still living. The low prevalence of "malignant" mutations detected may be due to screening a cohort of HCM patients alive with their disease at an average age at diagnosis of 42.5 years. In this study, all three patients having a "malignant" mutation were diagnosed before 25 years of age. However, based upon the published literature, these "malignant" mutations should have been represented in our cohort. The life expectancy for individuals with R403Q (MHY7), R719W (MHY7) and R92W (TNNT2) mutations was 33 to 38 years old (17,23,25). The mean age at SCD was 30 years for both R453C and G716R (MHY73) mutations (19,24). Moreover, 95 individuals in our cohort had a positive family history of HCM, and 69 probands had family members who had died suddenly due to their HCM. However, even in this high-risk subset with a declared malignant phenotype, only 1 of 69 probands (G716R, 1.4%) possessed a "malignant" mutation. The other four "malignant" mutations were absent in this high-risk subset.

Nonetheless, this patient cohort reflects the individuals who at presentation are seeking genetic testing for prognostic purposes. Thus, in this patient population, these "malignant" mutations are rare. Perhaps those individuals harboring one of these malignant mutations had already died and were not represented (35). Only a future study involving a molecular autopsy for these particular mutations in deceased patients with HCM could determine if there is a difference in the frequency of these so-called "malignant" mutations among the living and the dead.


    Conclusions
 Top
 Abstract
 Methods
 Results
 Discussion
 Conclusions
 References
 
Hypertrophic cardiomyopathy is the final common pathway for a large number of sarcomeric perturbations. The exact mechanisms mitigating hypertrophy and SCD remain unknown. Although it has been suggested that routine screening should be done for "malignant" mutations, our evaluation of a tertiary referral population of individuals with HCM suggests that such a targeted screen will elucidate very few cases. Informing a patient that they have a "benign" or "malignant" mutation has serious clinical implications. Because the genotype/phenotype associations are not unequivocally known, the clinical decision to proceed with primary prevention ICD therapy should not consider the patient’s fundamental disease-causing genetic substrate.

Despite this present limitation in molecular genetic testing for HCM, yesterday’s unraveling of the molecular basis for HCM as a primary genetic disease of the sarcomere combined with new insights from genotype-phenotype correlative studies have provided the framework for tomorrow’s improved understanding of the natural history and prognosis for a patient diagnosed with HCM. Although not yet a routine clinical test, HCM genotyping is already making a profound impact in the preclinical diagnosis of family members where, in fact, the HCM-causing mutation has been identified. In this situation, an unambiguous identification of relatives who do or do not possess the underlying genetic substrate for HCM is not only possible, but also clinically invaluable.


    Footnotes
 
Supported by a Mayo Foundation Clinic Research award to Dr. Ackerman.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 Conclusions
 References
 
1. Maron BJ, Epstein SE. Hypertrophic cardiomyopathy: a discussion of nomenclature. (editorial)Am J Cardiol. 1979;43:1242–1244[CrossRef][Medline]

2. Maron BJ, Gardin JM, Flack JM, Gidding SS, Kurosaki TT, Bild DE. Prevalence of hypertrophic cardiomyopathy in a general population of young adults: echocardiographic analysis of 4,111 subjects in the CARDIA study (Coronary Artery Risk Development in [Young] Adults). Circulation. 1995;92:785–789[Abstract/Free Full Text]

3. Maron BJ, Bonow RO, Cannon RO, Leon MB, Epstein SE. Hypertrophic cardiomyopathy: interrelations of clinical manifestations, pathophysiology, and therapy. N Engl J Med. 1987;316:780–789[Medline]

4. Maron BJ, Shen WK, Link MS, et al. Efficacy of implantable cardioverter-defibrillators for the prevention of sudden death in patients with hypertrophic cardiomyopathy. N Engl J Med. 2000;342:365–373[Abstract/Free Full Text]

5. Watkins H, Thierfelder L, Tyuichiro A, et al. Independent origin of identical beta cardiac myosin heavy-chain mutations in hypertrophic cardiomyopathy. Am J Hum Genet. 1993;53:1180–1185[Medline]

6. Consevage MW, Salada GC, Baylen BG, Ladda RL, Rogan PK. A new missense mutation, Arg719Gln, in the beta-cardiac heavy chain myosin gene of patients with familial hypertrophic cardiomyopathy. Hum Mol Genet. 1994;3:1025–1026[Free Full Text]

7. Geisterfer-Lowrance AA, Kass S, Tanigawa G, et al. A molecular basis for familial hypertrophic cardiomyopathy: a beta cardiac myosin heavy chain gene missense mutation. Cell. 1990;62:999–1006[CrossRef][Medline]

8. Rayment I, Holden HM, Sellers JR, Fananapazir L, Epstein ND. Structural interpretation of the mutations in the beta-cardiac myosin that have been implicated in familial hypertrophic cardiomyopathy. Proc Natl Acad Sci USA. 1995;92:3864–3868[Abstract/Free Full Text]

9. Thierfelder L, Watkins H, MacRae C, et al. Alpha-tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: a disease of the sarcomere. Cell. 1994;77:701–712[CrossRef][Medline]

10. Moolman JC, Corfield VA, Posen B, et al. Sudden death due to troponin T mutations. J Am Coll Cardiol. 1997;29:549–555[Abstract]

11. Seidman JG, Seidman C. The genetic basis for cardiomyopathy: from mutation identification to mechanistic paradigms. (review)Cell. 2001;104:557–567[CrossRef][Medline]

12. Kimura A, Harada H, Park JE, et al. Mutations in the cardiac troponin I gene associated with hypertrophic cardiomyopathy. Nat Genet. 1997;16:379–382[CrossRef][Medline]

13. Olson TM, Doan TP, Kishimoto NY, Whitby FG, Ackerman MJ, Fananapazir L. Inherited and de novo mutations in the cardiac actin gene cause hypertrophic cardiomyopathy. J Mol Cell Cardiol. 2000;32:1687–1694[CrossRef][Medline]

14. Mogensen J, Klausen IC, Pedersen AK, et al. Alpha-cardiac actin is a novel disease gene in familial hypertrophic cardiomyopathy. J Clin Invest. 1999;103:R39–43[Medline]

15. Satoh M, Takahashi M, Sakamoto T, Hiroe M, Marumo F, Kimura A. Structural analysis of the titin gene in hypertrophic cardiomyopathy: identification of a novel disease gene. Biochem Biophys Res Commun. 1999;262:411–417[CrossRef][Medline]

16. FHC Mutation Database. ANGIS. 2001. Available at:ghttp://morgan.angis.su.oz.au/Databases/Heart/heartbreak.html Accessed May 14, 2002

17. Anan R, Greve G, Thierfelder L, et al. Prognostic implications of novel beta cardiac myosin heavy chain gene mutations that cause familial hypertrophic cardiomyopathy. J Clin Invest. 1994;93:280–285[Medline]

18. Hengstenberg C, Schwartz K. Molecular genetics of familial hypertrophic cardiomyopathy. (published errata appear in J Mol Cell Cardiol 1994;26:276 and 1994:26:277)J Mol Cell Cardiol. 1994;26:3–10[CrossRef][Medline]

19. Watkins H, Rosenzweig A, Hwang DS, et al. Characteristics and prognostic implications of myosin missense mutations in familial hypertrophic cardiomyopathy. N Engl J Med. 1992;326:1108–1114[Abstract]

20. Epstein ND, Cohn GM, Cyran F, Fananapazir L. Differences in clinical expression of hypertrophic cardiomyopathy associated with two distinct mutations in the beta-myosin heavy chain gene: a 908Leu-Val mutation and a 403Arg-Gln mutation. Circulation. 1992;86:345–352[Abstract/Free Full Text]

21. Marian AJ, Kelly D, Mares A Jr, et al. A missense mutation in the beta myosin heavy chain gene is a predictor of premature sudden death in patients with hypertrophic cardiomyopathy. J Sports Med Phys Fitness. 1994;34:1–10[Medline]

22. Dausse E, Komajda M, Fetler L, et al. Familial hypertrophic cardiomyopathy: microsatellite haplotyping and identification of a hot spot for mutations in the beta-myosin heavy chain gene. J Clin Invest. 1993;92:2807–2813[Medline]

23. Marian AJ, Roberts R. Molecular genetic basis of hypertrophic cardiomyopathy: genetic markers for sudden cardiac death. J Cardiovasc Electrophysiol. 1998;9:88–99[Medline]

24. Hwang T, Lee W, Kimura A, et al. Early expression of a malignant phenotype of familial hypertrophic cardiomyopathy associated with a Gly716Arg myosin heavy chain mutation in a Korean family. Am J Cardiol. 1998;82:1509–1513[CrossRef][Medline]

25. Watkins H, McKenna WJ, Thierfelder L, et al. Mutations in the genes for cardiac troponin T and alpha-tropomyosin in hypertrophic cardiomyopathy. N Engl J Med. 1995;332:1058–1064[Abstract/Free Full Text]

26. Bryant R. Hypertrophic cardiomyopathy in children. Cardiol Rev. 1999;7:92–100[Medline]

27. St John Sutton M, Epstein JA. Hypertrophic cardiomyopathy—beyond the sarcomere. (editorial comment)N Engl J Med. 1998;338:1303–1304[Free Full Text]

28. Arbustini E, Fasani R, Morbini P, et al. Coexistence of mitochondrial DNA and beta myosin heavy chain mutations in hypertrophic cardiomyopathy with late congestive heart failure. (published erratum appears in Heart 1999;81:330)Heart. 1998;80:548–558[Abstract/Free Full Text]

29. Seidman Lab. 2001. Available at:http://genetics.med.harvard.edu/~seidman/sequenceprimers.tropt.html Accessed June 2000

30. Underhill PA, Jin L, Lin AA, et al. Detection of numerous Y chromosome biallelic polymorphisms by denaturing high-performance liquid chomatography. Genome Res. 1997;7:996–1005[Abstract/Free Full Text]

31. Ackerman MJ, Schroeder JJ, Berry R, et al. A novel mutation in KVLQT1 is the molecular basis of inherited long QT syndrome in a near-drowning patient’s family. Pediatr Res. 1998;44:148–153[Medline]

32. the Nomenclature Working GroupAntonarakis SE. Recommendations for a nomenclature system for human gene mutations. Hum Mutat. 1998;11:1–3[CrossRef][Medline]

33. Ackerman MJ, Clapham DE. Ion channels—basic science and clinical disease. N Engl J Med. 1997;336:1575–1586[Free Full Text]

34. Fananapazir L, Epstein ND. Genotype-phenotype correlations in hypertrophic cardiomyopathy: insights provided by comparisons of kindreds with distinct and identical beta-myosin heavy chain gene mutations. Circulation. 1994;89:22–32[Abstract/Free Full Text]

35. Varnava AM, Elliott PM, Baboonian C, Davison F, Davies MJ, McKenna WJ. Hypertrophic cardiomyopathy: histological features of sudden death in cardiac troponin T disease. Circulation. 2001;104:1380–1384[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Clin Med ResHome page
K. J. Hogan, J. K. Burmester, M. D. Caldwell, Q. H. Hogan, D. B. Coursin, D. N. Green, R. M.R. Selzer, T. P. Broderick, D. A. Rusy, M. Poroli, et al.
Perioperative Genomic Profiles Using Structure-Specific Oligonucleotide Probes
Clin. Med. Res., September 1, 2009; 7(3): 69 - 84.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
J. M. Bos, J. A. Towbin, and M. J. Ackerman
Diagnostic, prognostic, and therapeutic implications of genetic testing for hypertrophic cardiomyopathy.
J. Am. Coll. Cardiol., July 14, 2009; 54(3): 201 - 211.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
B. J. Maron, W. C. Roberts, M. Arad, T. S. Haas, P. Spirito, G. B. Wright, A. K. Almquist, J. M. Baffa, J. P. Saul, C. Y. Ho, et al.
Clinical Outcome and Phenotypic Expression in LAMP2 Cardiomyopathy
JAMA, March 25, 2009; 301(12): 1253 - 1259.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
G S Soor, A Luk, E Ahn, J R Abraham, A Woo, A Ralph-Edwards, and J Butany
Hypertrophic cardiomyopathy: current understanding and treatment objectives
J. Clin. Pathol., March 1, 2009; 62(3): 226 - 235.
[Abstract] [Full Text] [PDF]


Home page
Circ Cardiovasc GenetHome page
B. J. Maron, C. E. Seidman, M. J. Ackerman, J. A. Towbin, M. S. Maron, S. R. Ommen, R. A. Nishimura, and B. J. Gersh
How should hypertrophic cardiomyopathy be classified?: What's in a Name? Dilemmas in Nomenclature Characterizing Hypertrophic Cardiomyopathy and Left Ventricular Hypertrophy
Circ Cardiovasc Genet, February 1, 2009; 2(1): 81 - 86.
[Full Text] [PDF]


Home page
Circ Cardiovasc GenetHome page
P. Elliott and W. J. McKenna
How should hypertrophic cardiomyopathy be classified?: Molecular Diagnosis for Hypertrophic Cardiomyopathy: Not Ready for Prime Time
Circ Cardiovasc Genet, February 1, 2009; 2(1): 87 - 89.
[Full Text] [PDF]


Home page
J Am Coll Cardiol ImgHome page
M. Michels, O. I.I. Soliman, M. J. Kofflard, Y. M. Hoedemaekers, D. Dooijes, D. Majoor-Krakauer, and F. J. ten Cate
Diastolic abnormalities as the first feature of hypertrophic cardiomyopathy in Dutch myosin-binding protein C founder mutations.
J. Am. Coll. Cardiol. Img., January 1, 2009; 2(1): 58 - 64.
[Abstract] [Full Text] [PDF]


Home page
Mayo Clin Proc.Home page
I. Olivotto, F. Girolami, M. J. Ackerman, S. Nistri, J. M. Bos, E. Zachara, S. R. Ommen, J. L. Theis, R. A. Vaubel, F. Re, et al.
Myofilament Protein Gene Mutation Screening and Outcome of Patients With Hypertrophic Cardiomyopathy
Mayo Clin. Proc., June 1, 2008; 83(6): 630 - 638.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
I. Ostman-Smith, G. Wettrell, B. Keeton, D. Holmgren, U. Ergander, S. Gould, C. Bowker, and M. Verdicchio
Age- and gender-specific mortality rates in childhood hypertrophic cardiomyopathy
Eur. Heart J., May 1, 2008; 29(9): 1160 - 1167.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. A. Nishimura and S. R. Ommen
Hypertrophic Cardiomyopathy: The Search for Obstruction
Circulation, November 21, 2006; 114(21): 2200 - 2202.
[Full Text] [PDF]


Home page
J Am Coll CardiolHome page
D. A. Cesario and G. W. Dec
Implantable Cardioverter- Defibrillator Therapy in Clinical Practice
J. Am. Coll. Cardiol., April 18, 2006; 47(8): 1507 - 1517.
[Abstract] [Full Text] [PDF]


Home page
Mayo Clin Proc.Home page
J. Binder, S. R. Ommen, B. J. Gersh, S. L. Van Driest, A. J. Tajik, R. A. Nishimura, and M. J. Ackerman
Echocardiography-Guided Genetic Testing in Hypertrophic Cardiomyopathy: Septal Morphological Features Predict the Presence of Myofilament Mutations
Mayo Clin. Proc., April 1, 2006; 81(4): 459 - 467.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
E. Ladich, R. Virmani, and A. Burke
Sudden Cardiac Death not Related to Coronary Atherosclerosis
Toxicol Pathol, January 1, 2006; 34(1): 52 - 57.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
M. J. Perkins, S. L. Van Driest, E. G. Ellsworth, M. L. Will, B. J. Gersh, S. R. Ommen, and M. J. Ackerman
Gene-specific modifying effects of pro-LVH polymorphisms involving the renin-angiotensin-aldosterone system among 389 unrelated patients with hypertrophic cardiomyopathy
Eur. Heart J., November 2, 2005; 26(22): 2457 - 2462.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
M. J. Ackerman, S. L. Van Driest, and M. Bos
Are Longitudinal, Natural History Studies the Next Step in Genotype-Phenotype Translational Genomics in Hypertrophic Cardiomyopathy?
J. Am. Coll. Cardiol., November 1, 2005; 46(9): 1744 - 1746.
[Full Text] [PDF]


Home page
Mayo Clin Proc.Home page
S. L. Van Driest, S. R. Ommen, A. J. Tajik, B. J. Gersh, and M. J. Ackerman
Yield of Genetic Testing in Hypertrophic Cardiomyopathy
Mayo Clin. Proc., June 1, 2005; 80(6): 739 - 744.
[Abstract] [PDF]


Home page
Mayo Clin Proc.Home page
S. L. Van Driest, S. R. Ommen, A. J. Tajik, B. J. Gersh, and M. J. Ackerman
Sarcomeric Genotyping in Hypertrophic Cardiomyopathy
Mayo Clin. Proc., April 1, 2005; 80(4): 463 - 469.
[Abstract] [PDF]


Home page
J Am Coll CardiolHome page
J. Mogensen, R. T. Murphy, T. Kubo, A. Bahl, J. C. Moon, I. C. Klausen, P. M. Elliott, and W. J. McKenna
Frequency and clinical expression of cardiac troponin I mutations in 748 consecutive families with hypertrophic cardiomyopathy
J. Am. Coll. Cardiol., December 21, 2004; 44(12): 2315 - 2325.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
B. J. Maron, J.G. Seidman, and C. E. Seidman
Proposal for contemporary screening strategies in families with hypertrophic cardiomyopathy
J. Am. Coll. Cardiol., December 7, 2004; 44(11): 2125 - 2132.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
S. L. Van Driest, M. A. Jaeger, S. R. Ommen, M. L. Will, B. J. Gersh, A. J. Tajik, and M. J. Ackerman
Comprehensive analysis of the beta-myosin heavy chain gene in 389 unrelated patients with hypertrophic cardiomyopathy
J. Am. Coll. Cardiol., August 4, 2004; 44(3): 602 - 610.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
B. J. Maron, B. R. Chaitman, M. J. Ackerman, A. Bayes de Luna, D. Corrado, J. E. Crosson, B. J. Deal, D. J. Driscoll, N.A. M. Estes III, C. G. S. Araujo, et al.
Recommendations for Physical Activity and Recreational Sports Participation for Young Patients With Genetic Cardiovascular Diseases
Circulation, June 8, 2004; 109(22): 2807 - 2816.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
M. P Frenneaux
Assessing the risk of sudden cardiac death in a patient with hypertrophic cardiomyopathy
Heart, May 1, 2004; 90(5): 570 - 575.
[Full Text] [PDF]


Home page
HeartHome page
S L Van Driest, B J Maron, and M J Ackerman
From malignant mutations to malignant domains: the continuing search for prognostic significance in the mutant genes causing hypertrophic cardiomyopathy
Heart, January 1, 2004; 90(1): 7 - 8.
[Abstract] [Full Text] [PDF]


Home page
Mayo Clin Proc.Home page
M. J. Ackerman, D. J. Tester, G. S. Jones, M. L. Will, C. R. Burrow, and M. E. Curran
Ethnic Differences in Cardiac Potassium Channel Variants: Implications for Genetic Susceptibility to Sudden Cardiac Death and Genetic Testing for Congenital Long QT Syndrome
Mayo Clin. Proc., December 1, 2003; 78(12): 1479 - 1487.
[Abstract] [PDF]


Home page
J Am Coll CardiolHome page
B. J. Maron, W. J. McKenna, G. K. Danielson, L. J. Kappenberger, H. J. Kuhn, C. E. Seidman, P. M. Shah, W. H. Spencer III, P. Spirito, F. J. Ten Cate, et al.
American College of Cardiology/European Society of Cardiology Clinical Expert Consensus Document on Hypertrophic Cardiomyopathy: a report of the American College of Cardiology Foundation Task Force on Clinical Expert Consensus Documents and the European Society of Cardiology Committee for Practice Guidelines
J. Am. Coll. Cardiol., November 5, 2003; 42(9): 1687 - 1713.
[Full Text] [PDF]


Home page
Eur Heart JHome page
Writing Committee Members, B. J. Maron, W. J. McKenna, G. K. Danielson, L. J. Kappenberger, H. J. Kuhn, C. E. Seidman, P. M. Shah, W. H. Spencer III, P. Spirito, et al.
American College of Cardiology/European Society of Cardiology Clinical Expert Consensus Document on Hypertrophic Cardiomyopathy: A report of the American College of Cardiology Foundation Task Force on Clinical Expert Consensus Documents and the European Society of Cardiology Committee for Practice Guidelines
Eur. Heart J., November 1, 2003; 24(21): 1965 - 1991.
[Full Text] [PDF]


Home page
HeartHome page
A Woo, H Rakowski, J C Liew, M-S Zhao, C-C Liew, T G Parker, M Zeller, E D Wigle, and M J Sole
Mutations of the {beta} myosin heavy chain gene in hypertrophic cardiomyopathy: critical functional sites determine prognosis
Heart, October 1, 2003; 89(10): 1179 - 1185.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
B J Maron
Contemporary considerations for risk stratification, sudden death and prevention in hypertrophic cardiomyopathy
Heart, September 1, 2003; 89(9): 977 - 978.
[Full Text] [PDF]


Home page
Clin. Chem.Home page
M. Garcia-Castro, J. R. Reguero, A. Batalla, B. Diaz-Molina, P. Gonzalez, V. Alvarez, A. Cortina, G. I. Cubero, and E. Coto
Hypertrophic Cardiomyopathy: Low Frequency of Mutations in the {beta}-Myosin Heavy Chain (MYH7) and Cardiac Troponin T (TNNT2) Genes among Spanish Patients
Clin. Chem., August 1, 2003; 49(8): 1279 - 1285.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. L. Van Driest, E. G. Ellsworth, S. R. Ommen, A. J. Tajik, B. J. Gersh, and M. J. Ackerman
Prevalence and Spectrum of Thin Filament Mutations in an Outpatient Referral Population With Hypertrophic Cardiomyopathy * Note Added in Proof
Circulation, July 29, 2003; 108(4): 445 - 451.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
C Hengstenberg, J Erdmann, and P Charron
Outcome of clinical versus genetic family screening in hypertrophic cardiomyopathy with focus on cardiac beta-myosin gene mutations: Prediction of clinical status--is molecular genetics a new tool for the management of hypertrophic cardiomyopathy in clinical practice?
Cardiovasc Res, February 1, 2003; 57(2): 298 - 301.
[Full Text] [PDF]


Home page
CirculationHome page
S. L. Van Driest, M. J. Ackerman, S. R. Ommen, R. Shakur, M. L. Will, R. A. Nishimura, A. J. Tajik, and B. J. Gersh
Prevalence and Severity of "Benign" Mutations in the {beta}-Myosin Heavy Chain, Cardiac Troponin T, and {alpha}-Tropomyosin Genes in Hypertrophic Cardiomyopathy
Circulation, December 10, 2002; 106(24): 3085 - 3090.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
W. J. McKenna, J. Mogensen, and P. M. Elliott
Role of genotyping in risk factor assessment for sudden death in hypertrophic cardiomyopathy
J. Am. Coll. Cardiol., June 19, 2002; 39(12): 2049 - 2051.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ackerman, M. J.
Right arrow Articles by Gersh, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ackerman, M. J.
Right arrow Articles by Gersh, B. J.

 
  CME Topic Collections Past Issues Search Current Issue Home

Advertisement