Advertisement






Click here for more guidelines.
CME Topic Collections Past Issues Search Current Issue Home
     

J Am Coll Cardiol, 2001; 38:1539-1545
© 2001 by the American College of Cardiology Foundation
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nishikawa, N.
Right arrow Articles by Hori, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nishikawa, N.
Right arrow Articles by Hori, M.

EXPERIMENTAL STUDY

Long-term administration of amlodipine prevents decompensation to diastolic heart failure in hypertensive rats

Nagahiro Nishikawa, MD*, Tohru Masuyama, MD, PhD, FACC*,*, Kazuhiro Yamamoto, MD, PhD, FACC*, Yasushi Sakata, MD*, Toshiaki Mano, MD, PhD*, Takeshi Miwa, PhD{dagger}, Motoaki Sugawara, PhD{ddagger} and Masatsugu Hori, MD, PhD, FACC*

* Department of Internal Medicine and Therapeutics (A8), Suita, Japan
{dagger} Genome Information Research Center, Osaka University, Suita, Japan
{ddagger} Department of Cardiovascular Sciences, Tokyo Women’s Medical University, Tokyo, Japan

Manuscript received April 26, 2001; revised manuscript received July 10, 2001, accepted July 26, 2001.

* Reprint requests and correspondence: Dr. Tohru Masuyama, Department of Internal Medicine and Therapeutics (A8), Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita 565-0871, Japan
masuyama{at}medone.med.osaka-u.ac.jp


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
OBJECTIVES

We assessed the effects of long-term amlodipine administration in a diastolic heart failure (DHF) rat model with preserved systolic function as well as the relationship between changes in left ventricular (LV) myocardial stiffening and alterations in extracellular matrix.

BACKGROUND

Although the effect of long-term administration of amlodipine has been shown to be disappointing in patients with systolic failure, the effect is unknown in those with DHF.

METHODS

Dahl salt-sensitive rats fed a high-salt diet for seven weeks were divided into three groups: eight untreated rats (DHF group), eight rats given high-dose amlodipine (10 mg/kg/day; HDA group) and seven rats given low-dose amlodipine (1 mg/kg/day; LDA group).

RESULTS

High-dose administration of amlodipine decreased systolic blood pressure and controlled excessive hypertrophy, without a decrease in the collagen content, and prevented the elevation of LV end-diastolic pressure at 19 weeks. Low-dose administration of amlodipine with subdeppressive effects did not control either hypertrophy or fibrosis; however, it prevented myocardial stiffening and, hence, the elevation of LV end-diastolic pressure. The ratio of type I to type III collagen messenger ribonucleic acid levels was significantly lower in both the HDA and LDA groups than in the DHF group.

CONCLUSIONS

Long-term administration of amlodipine prevented the transition to DHF both at the depressor and subdepressor doses. Amlodipine did not decrease the collagen content, but attenuated myocardial stiffness, with inhibition of the phenotype shift from type III to type I collagen. Thus, amlodipine may exert beneficial effects through amelioration of collagen remodeling in the treatment of DHF.

Abbreviations and Acronyms
  BP = blood pressure
  CHF = congestive heart failure
  Dahl-SS = Dahl-Iwai salt-sensitive rats
  DHF = diastolic heart failure
  ECM = extracellular matrix
  HDA = high-dose amlodipine
  LDA = low-dose amlodipine
  LV = left ventricular
  mRNA = messenger ribonucleic acid
  MSC = myocardial stiffness constant
  PRAISE II = Prospective Randomized AmlodIpine Survival Evaluation II
  tau = time constant of isovolumic left ventricular pressure fall


Calcium antagonists have been used in the treatment of hypertension or heart failure because they have vasodilating effects, resulting in a reduction of myocardial oxygen demand. However, recent clinical studies have shown that long-term administration of short-acting calcium antagonists may increase the mortality of patients with heart failure (1). Although amlodipine, as a long-acting, dihydropyridine-based calcium antagonist, was expected to bring more beneficial results, the Prospective Randomized AmlodIpine Survival Evaluation II (PRAISE II) trial failed to demonstrate its benefit in patients with nonischemic heart failure. All of the patients studied in the PRAISE II trial, however, had marked left ventricular (LV) systolic dysfunction, and we may safely say that the effect of long-term administration in patients with another type of heart failure—diastolic heart failure (DHF) with preserved LV systolic function—remains totally unclear. In fact, 30% to 50% of patients with congestive heart failure (CHF) have demonstrated LV diastolic dysfunction with preserved systolic function, i.e., isolated DHF, and their most common underlying cardiovascular disease is hypertensive heart disease (2,3).

Recently, our laboratory developed a rat model of DHF in which compensated LV hypertrophy (4) is followed by the progression of LV fibrosis and renin-angiotensin-system–dependent excessive hypertrophy, resulting in hemodynamic alterations consistent with CHF (5). Left ventricular myocardial stiffening is not associated with LV dilation or systolic dysfunction, even at the end-stage of heart failure in this model (6,7). This model was used to study the preventive effects of long-term amlodipine administration in the transition to DHF and, if effective, to clarify its mechanism. In studying the mechanism, we exclusively focused on the depressor effect and effects on extracellular matrix (ECM) regulation, because myocardial stiffening is considered to be closely related to ECM components, particularly collagen, in our model of DHF.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
This study conforms to the guiding principles of Osaka University Graduate School of Medicine, with regard to animal care, and to the "Guide for the Care and Use of Laboratory Animals," published by the National Institutes of Health, Bethesda, Maryland.

Study subjects.   Laboratory chow containing 0.3% sodium chloride was fed to weaning male Dahl-Iwai salt-sensitive (Dahl-SS) rats (DIS/Eis, Eisai, Tokyo, Japan) until their diet was switched to laboratory chow containing 8% sodium chloride at seven weeks of age. The rats were randomized to no treatment (DHF group, n = 8) or treatment with a calcium channel antagonist, amlodipine at 1 mg/kg per day (low-dose amlodipine [LDA] group, n = 7) or 10 mg/kg per day (high-dose amlodipine [HDA] group, n = 8), courtesy of Sumitomo Pharmaceuticals Company, from eight weeks of age. Amlodipine was given by gastric lavage every morning. Laboratory chow containing 0.3% sodium chloride was continuously fed to the male Dahl-SS rats, and they comprised the age-matched control group (n = 6). Systolic blood pressure (BP) and heart rate were obtained at 7, 13, 15, 17 and 19 weeks of age, with a tail-cuff system (BP-98A, Softron, Tokyo, Japan).

Echocardiographic and hemodynamic studies.   Transthoracic echocardiographic recordings were obtained at 19 weeks of age, as previously described (4). Specifically, the rats were anesthetized with intraperitoneal administration of ketamine hydrochloride (50 mg/kg) and xylazine hydrochloride (10 mg/kg), and an echocardiographic machine equipped with a 7.5-MHz transducer (SONOS 2000, Philips Medical Systems Corp., Best, Netherlands) was used to make M-mode LV echocardiographic recordings at a paper speed of 100 mm/s. Left ventricular fractional shortening was calculated as described previously (4). Mid-wall fractional shortening was calculated according to the two-shell cylindrical model of Shimizu et al. (8) to avoid overestimation of systolic function in the hypertrophied heart, as described previously (4).

After the echocardiographic study, high-fidelity LV pressure was recorded to determine LV end-diastolic pressure, as previously described (4). The digitized LV pressure recording was also used to calculate the time constant of isovolumic LV pressure fall (tau), using a non-zero asymptote method, as previously described (9).

Determination of myocardial stiffness constant.   Simultaneous recordings of LV pressure and LV M-mode echocardiography were obtained in all of the rats studied, and myocardial stiffness constant (MSC) was obtained according to the method of Sugawara et al. (7,10), as previously described. The mean value of MSC of the septum and posterior wall was used for statistical analysis.

Tissue sampling.   After hemodynamic studies, adequate anesthesia was achieved by additional intraperitoneal administration of ketamine hydrochloride (50 mg/kg) and xylazine hydrochloride (10 mg/kg). After an incision was made in the chest, the heart was quickly harvested. The apical site of the LV below the papillary muscle was removed, weighed, immediately placed in liquid nitrogen and stored at –80°C for measurement of the hydroxyproline content (6). The results were calculated as the hydroxyproline content per wet weight of tissue. Samples of the LV for measurement of the amount of messenger ribonucleic acid (mRNA) were weighed, immediately placed in liquid nitrogen and stored at –80°C. Samples for immunohistochemistry were weighed, immersed in Tissue-Tek O.C.T. compound (Sakura Finetechnical Co., Tokyo, Japan) and frozen at –80°C. The summed LV weight corrected for body weight was determined as the LV mass index.

Immunohistochemistry.   Serial cryostat transverse sections of 5-µm thickness were fixed in acetone for 10 min, air-dried and stained by the indirect immunohistologic method. Tissue sections were treated with 0.3% H2O2 solution for 10 min to inhibit endogenous peroxidase activity and then incubated with blocking solution (10% donkey serum, Rockland, Maine), followed by 2-h incubation with rabbit polyclonal rat type I collagen antiserum (1:2,000 dilution, LSL, Tokyo, Japan) or rabbit polyclonal rat type III collagen antiserum (1:500 dilution, Chemicon, Temecala, California). After washing in phosphate-buffered saline for 10 min, the sections were incubated with secondary donkey anti-rabbit antibody and visualized with 3-amino-9-ethyl carbazole (Zymed Laboratories, San Francisco, California) as substrate. The nuclei were stained with hematoxylin, and the sections were viewed with a light microscope at a magnification of x400.

Quantification of mRNA levels of types I and III collagen.   The amount of collagen mRNA in the LV was determined by real-time quantitative polymerase chain reaction with the Prism 7700 Sequence Detector (Perkin-Elmer Corp., Foster, California), as previously described (6,11). The sequences of all oligonucleotides used for type I collagen mRNA were TGCTGCTTGCAGTAACGTCG as the forward primer, TCAACACCATCTCTGCCTCG as the reverse primer and ACTGGAGACAGAGGACCGCGTGGAC as the detection probe. The sequences of all oligonucleotides used for type III collagen mRNA were TGCCCACAGCCTTCTACACCT as the forward primer, CAGCCATTCCTCCCACTCCAG as the reverse primer and CTCCTGTGCTTCCTGATGGCCATGGACC as the detection probe.

To correct the efficiency of complementary deoxyribonucleic acid synthesis, the amounts of each measured mRNA were divided by the amounts of glyceraldehyde-3-phosphate dehydrogenase mRNA used as internal standards. Each mRNA preparation was measured in at least three individual experiments.

Statistics.   The results are expressed as the mean value ± SEM. The statistical analysis was conducted with a commercially available statistical software program (Statview version 5.0, SAS Institute, Cary, North Carolina). The differences at specific stages among the groups were assessed using one-way analysis of variance and the Fisher protected least significant difference test. Bivariate correlations between variables were assessed by simple least-squares linear regression analysis. A probability value <0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Hemodynamic effect of amlodipine administration.   Systolic BP was significantly higher in the DHF rats at 13 weeks than in the control rats and thereafter (Fig. 1). At 19 weeks, LV end-diastolic pressure and the ratio of lung weight to body weight were greater in the DHF rats than in the control rats, indicating the presence of CHF in DHF rats (Table 1). Echocardiographically determined posterior wall thickness and LV mass index were greater in the DHF rats than in the control rats, but there was no significant difference in the LV end-diastolic dimension or mid-wall fractional shortening. Left ventricular systolic function, as assessed with mid-wall fractional shortening, was preserved in DHF rats; however, tau was prolonged and MSC was increased in the DHF rats as compared with control rats.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1 Serial changes in systolic blood pressure in the control, diastolic heart failure (DHF), high-dose amlodipine (administered amlodipine of high dose [HDA]) and low-dose amlodipine (administered amlodipine of low dose [LDA]) rats. Data were obtained at the ages of 7, 13, 15, 17 and 19 weeks. Data are presented as the mean value ± SEM. *p < 0.05 vs. control group; #p < 0.05 vs. DHF group; {dagger}p < 0.05 vs. high-dose amlodipine group at the same point.

 

View this table:
[in this window]
[in a new window]
 
Table 1 Hemodynamic and Structural Characteristics of Each Group at 19 Weeks

 
Elevation of systolic BP was suppressed in the HDA group at 13 weeks and thereafter, but not in the LDA group, and there was no difference in systolic BP between the DHF and LDA groups (Fig. 1). The LV mass index and LV end-diastolic dimension decreased at 19 weeks in the HDA group as compared with the DHF group, but the decrease in LV mass was not observed in the LDA group (Table 1). Long-term amlodipine administration did not affect mid-wall fractional shortening. In the HDA group, tau was shorter and MSC was smaller than those values in the DHF group. In the LDA group, tau was not shortened, but there was a decrease in MSC, as compared with the DHF group. Left ventricular end-diastolic pressure and the ratio of lung weight to body weight were normal in both the HDA and LDA groups, suggesting a prevention of CHF in the HDA and LDA groups.

LV fibrotic change and myocardial stiffness.   When the hydroxyproline content in the LV was compared among the groups, it was greater in the HDA and LDA groups than in the control group, and the values were similar to those of the DHF group (Fig. 2). The mRNA levels of types I and III collagen were greater in the DHF group than in the control group. The mRNA level of type I collagen was reduced, but was still beyond the control value, and that of type III collagen was not reduced in both the HDA or LDA group. Figure 3 illustrates immunoreactive fibrillar type I collagen protein deposition in the LV sections. An increase in type I collagen was observed in the DHF rat as compared with the control rat. A visible reduction in the level of type I collagen was noted in the order of the control, HDA and LDA rats (Fig. 3). In contrast, immunohistochemical staining of type III collagen did not appear different among DHF, AMH and AML rats.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 2 Hydroxyproline content of the left venticle (Pro-OH) and the ratio of type I to type III collagen mRNA levels (collagen I/III ratio) in the control, diastolic heart failure (DHF), high-dose amlodipine (administered amlodipine of high dose [HDA]) and low-dose amlodipine (administered amlodipine of low dose [LDA]) groups in the heart failure stage at 19 weeks (upper). *p < 0.05 vs. control group; #p < 0.05 vs. DHF group. The correlation between myocardial stiffness constant (MSC) and Pro-OH or the collagen I/III ratio was determined in pooled data taken from all of the rats (n = 22) (lower).

 


View larger version (161K):
[in this window]
[in a new window]
 
Figure 3 Immunohistochemical staining of the myocardium from a Dahl-SS rat with type I collagen in the LV (control rat, upper left), an untreated rat (diastolic heart failure [DHF], upper right) and a rat treated with high-dose amlodipine ( administered amlodipine of high dose [HDA], lower left) and low-dose amlodipine (administered amlodipine of low dose [LDA]) at 19 weeks. An increase in type I collagen was observed in the DHF rat as compared with the control rat. A visible reduction in the level of type I collagen was noted in the order of the control, high-dose amlodipine and low-dose amlodipine rats.

 
The ratio of type I to type III collagen mRNA levels was increased by fourfold in the DHF group as compared with the control group (Fig. 2). Although amlodipine administration did not decrease the hydroxyproline content, it decreased the ratio of type I to type III collagen mRNA, and its ratio was similar to that of the control group. In pooled data taken from all 22 rats, there was a weak correlation between MSC and the hydroxyproline content (r = 0.479, p < 0.05), and MSC correlated better with the ratio of type I to type III collagen mRNA levels (r = 0.856, p < 0.0001) (Fig 2).


    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Long-term administration of amlodipine prevented the elevation of LV end-diastolic pressure and the transition to overt DHF in a hypertensive heart model. Such preventive effects were not provided through LV systolic function and were different with the doses of administration. High-dose (10 mg/kg/day) administration showed an antihypertensive effect. Although this antihypertensive effect was not enough to normalize the BP to the level of the control group, it preserved systolic function and prevented diastolic dysfunction without suppressing compensatory or early hypertrophy. At this dose, amlodipine administration prevented DHF mainly by suppressing BP and excessive hypertrophy. Low-dose (1 mg/kg/day) administration, which was a subdeppessor dose, did not prevent progression of LV hypertrophy. It did not improve a reference of LV relaxation, tau, but significantly decreased MSC. Thus, improvement of myocardial stiffness obtained by a subdeppessor dose of amlodipine was likely to contribute to the prevention of DHF.

Although amlodipine administration did not alter the hydroxyproline content, it normalized the ratio of type I to type III collagen mRNA levels, which were significantly increased in the DHF group as compared with the control group. The MSC was correlated with the hydroxyproline content, and a better correlation was obtained between MSC and the ratio of type I to type III collagen mRNA levels. Thus, myocardial stiffening was likely related to a phenotype shift of collagen rather than to the collagen content, and amlodipine was effective in the prevention of collagen remodeling and of the transition to DHF.

Preventive effect of DHF by amlodipine administration.   In this study, high-dose administration of amlodipine decreased BP and LV end-diastolic pressure. The afterload and preload reductions may contribute to the prevention of excessive hypertrophy and, hence, the transition to DHF.

Short-acting calcium antagonists, such as verapamil, diltiazem and nifedipine, have shown potentially unfavorable effects, and the reason for these effects has been considered as negative inotropic effects, reflex activation of the sympathetic nervous system and activation of the rennin-angiotensin system (1,12). In contrast, Abernethy et al. (13) showed that the increase in plasma levels of norepinephrine, epinephrine, renin and aldosterone could be prevented with amlodipine treatment. Lund-Johansen et al. (14) showed an increase in plasma norepinephrine levels in patients with nifedipine-treated essential hypertension, but not in amlodipine-treated patients. Thus, the long-acting calcium antagonist amlodipine may avoid abnormal activation of the rennin-angiotensin system and reflex stimulation of the sympathetic nervous system. In our previous study (15), administration of a subdeppressor dose of the angiotensin II type 1 receptor antagonist, candesartan cilexetil, did not suppress the initial development of LV hypertrophy in hypertensive rats; however, the transition to DHF was suppressed by prevention of further progressive hypertrophy and fibrosis. Thus, we believe excessive hypertrophy plays an important role in the development of DHF, and that this type of hypertrophy is dependent on the rennin-angiotensin system. In the present study, administration of HDA prevented the development of excessive hypertrophy and, hence, DHF. This effect may be at least partly related to inactivation of the rennin-angiotensin system. The preventive effects of LDA, however, cannot be explained in the same way as those of HDA, because LV excessive hypertrophy was not prevented by the use of LDA.

Myocardial fibrosis and MSC.   A weak but significant correlation between MSC and the hydroxyproline content of the LV indicates an inter-relationship between myocardial stiffening and myocardial fibrosis in our model of DHF. Brilla et al. (16) demonstrated a close relationship between myocardial fibrosis and myocardial diastolic stiffness in spontaneously hypertensive rats that had heart failure due to systolic dysfunction. The results of the current study also emphasize the crucial role of myocardial fibrosis in the induction of myocardial stiffening and DHF. However, the correlation coefficient between the collagen content and MSC was not high in this study, and factors other than the collagen content may also contribute to myocardial stiffening.

Phenotype shift of collagen and MSC.   There are at least six phenotypes of collagen (17,18), and types I and III collagen are essential components of the myocardial ECM (19,20). Type I collagen production was more upregulated than type III collagen production in DHF rats. The change in the regulation of collagen production was associated with a similar change in the protein level, as evidenced by immunohistochemical findings. Types I and III collagen play different roles in maintaining myocardial structural and functional integrity: type I collagen mainly exerts rigidity, whereas type III collagen contributes to elasticity (21–23). Thus, the increase in the ratio of type I to type III collagen may well exacerbate myocardial stiffness. Previous animal and human studies have reported a phenotype shift of collagen in systolic heart failure (24–26). Weber et al. (27) showed that the phenotype shift was likely responsible for systolic dysfunction. However, both systolic and diastolic functions are impaired in the presence of systolic heart failure and are closely related with each other. The present study has expanded the findings of previous studies by demonstrating a close relationship between a phenotype shift of collagen and myocardial stiffening, as well as the crucial role of a phenotype shift in DHF.

Amlodipine and fibrosis.   Although LDA did not prevent the development of excessive hypertrophy, it reduced MSC and prevented elevation of LV end-diastolic pressure, as well as development of DHF, without a decrease in the myocardial collagen content. Yamazaki et al. (28) showed that amlodipine administration strongly reduced type I collagen gene expression in spontaneously hypertensive rats. In the present study, the decrease in type I collagen expression was also observed in the amlodipine-treated groups. Amlodipine administration reduced the ratio of type I to type III collagen, which may likely account for the decrease in MSC and, hence, the prevention of DHF. Thus, the inhibition of a phenotype shift of collagen by amlodipine administration may play an important role in the prevention of DHF achieved by LDA. Most recently, PRAISE II failed to demonstrate any beneficial effects of long-term amlodipine administration on the total mortality of patients with nonischemic cardiomyopathy with LV systolic dysfunction; however, our results suggest beneficial effects of amlodipine in patients with DHF that shows pathophysiologic findings different from those of systolic heart failure (6,29).

Study limitations.   There are several limitations of this study. First, myocardial stiffening may well be affected by alterations in the three-dimensional structure of the ECM, such as struts, weave and strands (22), changes in myocardial cross linking (27,30), myocardial ischemia and edema and coronary engorgement. The current study did not assess these changes, and future studies are necessary. However, a close correlation was observed between a phenotype shift of collagen and myocardial stiffness, and a lack of such data may not weaken our conclusions. It is not clarified in the current study whether the calcium antagonist directly affects collagen synthesis or degradation, or both, or exerts its effects indirectly through modulating other neurohumoral systems, such as the renin-angiotensin-aldosterone system. This should be clarified in future studies.

Second, MSC was calculated only in the septum and posterior wall. This is because MSC was determined with LV M-mode echocardiography. However, LV hypertrophy in our rats was symmetrical, and the difference in MSC between the septum and posterior wall was certainly small.

Conclusions.   Myocardial stiffening is facilitated by a phenotype shift from type III to type I collagen in the LV, rather than by an increase in the collagen content in hypertensive hearts. Thus, not only the reduction in the collagen content, but also the prevention of the phenotype shift should be a target for therapy of DHF, and amlodipine may exert its beneficial effects through amelioration of collagen remodeling in the treatment of DHF.


    Acknowledgments
 
We are grateful to Mr. Toshikazu Ogawa for his expert advice on the immunohistochemical study and to Ms. Haruka Kobayashi and Mayumi Shinzaki for their technical assistance.


    Footnotes
 
This study was supported in part by research grants from the Research for the Future Program (JSPS-RFTF 97100402) of the Japanese Society for the Promotion of Science and the Naito Foundation.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
1. Furberg C, Psaty B, Meyer J. Nifedipine: dose-related increase in mortality in patients with coronary heart disease. Circulation. 1995;92:1326–1331[Abstract/Free Full Text]

2. Vasan RS, Benjamin EJ, Levy D. Prevalence, clinical features and prognosis of diastolic heart failure: an epidemiologic perspective. J Am Coll Cardiol. 1995;26:1565–1574[Abstract]

3. Vasan RS, Larson MG, Benjamin EJ, Evans JC, Reiss CK, Levy D. Congestive heart failure in subjects with normal versus reduced left ventricular ejection fraction. J Am Coll Cardiol. 1999;33:1948–1955[Abstract/Free Full Text]

4. Doi R, Masuyama T, Yamamoto K, et al. Development of different phenotypes of hypertensive heart failure: systolic versus diastolic failure in Dahl salt-sensitive rats. J Hypertens. 2000;18:111–120[Medline]

5. Yamamoto K, Masuyama T, Sakata Y, et al. Role of renin-angiotensin and endothelin systems in development of diastolic heart failure in hypertensive hearts. Cardiovasc Res. 2000;47:274–283[Abstract/Free Full Text]

6. Yamamoto K, Masuyama T, Sakata Y, et al. Local neurohumoral regulation in the transition to isolated diastolic heart failure in hypertensive heart disease: absence of AT1 receptor downregulation and ‘overdrive’ of endothelin system. Cardiovasc Res. 2000;46:421–432[Abstract/Free Full Text]

7. Masuyama T, Yamamoto K, Sakata Y, et al. Evolving changes in Doppler mitral flow velocity pattern in rats with hypertensive hypertrophy. J Am Coll Cardiol. 2000;36:2333–2338[Abstract/Free Full Text]

8. Shimizu G, Hirota Y, Kita Y, Kawamura K, Saito T, Gaasch WH. Left ventricular midwall mechanics in systemic arterial hypertension. Circulation. 1991;83:1676–1684[Abstract/Free Full Text]

9. Yamamoto K, Masuyama T, Doi Y, et al. Noninvasive assessment of left ventricular relaxation using continuous-wave Doppler aortic regurgitant velocity curve: its comparative value to the mitral regurgitation method. Circulation. 1995;91:192–200[Abstract/Free Full Text]

10. Sugawara M, Nakano K. A method of analyzing regional myocardial function: mean wall stress-area strain relationship. Jpn Circ J. 1987;51:12–14

11. Sakata Y, Masuyama T, Yamamoto K, et al. Calcineurin inhibitor attenuates left ventricular hypertrophy leading to prevention of heart failure in hypertensive rats. Circulation. 2000;102:2269–2275[Abstract/Free Full Text]

12. Donnelly R, Elliott H, Meredith P, Kelman A, Reid J. Nifedipine: individual responses and concentration-effect relationships. Hypertension. 1988;12:443–449[Abstract/Free Full Text]

13. Abernethy D, Gutkowska J, Lambert M. Amlodipine in elderly hypertensive patients: pharmacokinetics and pharmacodynamics. J Cardiovasc Pharmacol 1988;12 Suppl 7:S67–71.

14. Lund-Johansen P, White W, Digranes O, Helland B, Jordal O, Stray T. Long-term haemodynamic effects of amlodipine at rest and during exercise in essential hypertension. J Hypertens. 1990;8:1129–1136[CrossRef][Medline]

15. Sakata Y, Masuyama T, Yamamoto K, et al. Renin-angiotensin system–dependent hypertrophy as a contributor to heart failure in hypertensive rats: different characteristics from renin-angiotensin system–independent hypertrophy. J Am Coll Cardiol. 2001;37:293–299[Abstract/Free Full Text]

16. Brilla CG, Janicki JS, Weber KT. Impaired diastolic function and coronary reserve in genetic hypertension. Circ Res. 1991;69:107–115[Abstract/Free Full Text]

17. Borg TK, Gay RE, Johnson LD. Changes in the distribution of fibronectin and collagen during development of the neonatal rat heart. Collagen Relat Res. 1982;2:211–218

18. Bashey RI, Martinez-Hernandez A, Jimenez SA. Isolation, characterization, and localization of cardiac collagen type VI: associations with other extracellular matrix components. Circ Res. 1992;70:1006–1017[Abstract/Free Full Text]

19. Borg TK, Caulfield JB. The collagen matrix of the heart. Fed Proc. 1981;40:2037–2041[Medline]

20. Weber K. Cardiac interstitium in health and disease: the fibrillar collagen network. J Am Coll Cardiol. 1989;13:1637–1652[Abstract]

21. Marijianowski MMH, Teeling P, Mann J, Becker AE. Dilated cardiomyopathy is associated with an increase in the type I/type III collagen ratio: a quantitative assessment. J Am Coll Cardiol. 1995;25:1263–1272[Abstract]

22. Weber KT, Janicki JS, Pick R, et al. Collagen in the hypertrophied, pressure-overloaded myocardium. Circulation 1987;75 Suppl I:I40–7.

23. Weber KT, Brilla CG. Pathological hypertrophy and cardial interstitium: fibrosis and renin-angiotensin-aldosterone system. Circulation. 1991;83:1849–1865[Abstract/Free Full Text]

24. Mukherjee D, Sen S. Collagen phenotypes during development and regression of myocardial hypertrophy in spontaneously hypertensive rats. Circ Res. 1990;67:1474–1480[Abstract/Free Full Text]

25. Dixon IMC, Ju H, Reid NL, Fleur TS, Werner JP, Jasmin G. Cardiac collagen remodeling in the cardiomyopathic Syrian hamster and the effect of losartan. J Mol Cell Cardiol. 1997;29:1837–1850[CrossRef][Medline]

26. Pauschinger M, Knopf D, Petschauer S, et al. Dilated cardiomyopathy is associated with significant changes in collagen I/III ratio. Circulation. 1999;99:2750–2756[Abstract/Free Full Text]

27. Weber KT, Janicki JS, Shoroff SG, Pick R, Chen RM, Bashey RI. Collagen remodeling of pressure-overload, hypertrophied non-human promate myocardium. Circ Res. 1988;62:757–765[Abstract/Free Full Text]

28. Yamazaki T, Komuro I, Zou Y, et al. Efficient inhibition of the development of cardiac remodeling by a long-acting calcium antagonist amlodipine. Hypertension. 1998;31:32–38[Abstract/Free Full Text]

29. Goldsmith SR, Dick C. Differentiating systolic from diastolic heart failure: pathophysiologic and therapeutic considerations. Am J Med. 1993;95:645–655[CrossRef][Medline]

30. Berg TJ, Hildebrandt P, Snorgaard O, et al. Serum levels of advanced glycation end products are associated with left ventricular diastolic function in patients with type 1 diabetes. Diabetes Care. 1999;22:1186–1190[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
JAOA: Journal of the American Osteopathic AssociationHome page
S. Dhar, D. Koul, and G. E. D'Alonzo Jr
Current Concepts in Diastolic Heart Failure
J Am Osteopath Assoc, April 1, 2008; 108(4): 203 - 209.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
T. Ohtani, M. Ohta, K. Yamamoto, T. Mano, Y. Sakata, M. Nishio, Y. Takeda, J. Yoshida, T. Miwa, M. Okamoto, et al.
Elevated cardiac tissue level of aldosterone and mineralocorticoid receptor in diastolic heart failure: beneficial effects of mineralocorticoid receptor blocker
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2007; 292(2): R946 - R954.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
K. Yamamoto, Y. Takahashi, T. Mano, Y. Sakata, N. Nishikawa, J. Yoshida, Y. Oishi, M. Hori, T. Miwa, S. Inoue, et al.
N-Methylethanolamine attenuates cardiac fibrosis and improves diastolic function: inhibition of phospholipase D as a possible mechanism
Eur. Heart J., July 2, 2004; 25(14): 1221 - 1229.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
N. Nishikawa, K. Yamamoto, Y. Sakata, T. Mano, J. Yoshida, T. Miwa, H. Takeda, M. Hori, and T. Masuyama
Differential activation of matrix metalloproteinases in heart failure with and without ventricular dilatation
Cardiovasc Res, March 1, 2003; 57(3): 766 - 774.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
K. Yamamoto, T. Masuyama, Y. Sakata, N. Nishikawa, T. Mano, J. Yoshida, T. Miwa, M. Sugawara, Y. Yamaguchi, T. Ookawara, et al.
Myocardial stiffness is determined by ventricular fibrosis, but not by compensatory or excessive hypertrophy in hypertensive heart
Cardiovasc Res, July 1, 2002; 55(1): 76 - 82.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nishikawa, N.
Right arrow Articles by Hori, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nishikawa, N.
Right arrow Articles by Hori, M.

 
  CME Topic Collections Past Issues Search Current Issue Home

Advertisement