EXPERIMENTAL STUDY
Interaction between paracrine tumor necrosis factor-alpha and paracrine angiotensin II during myocardial ischemia
Inna Frolkis, MD, PhDa,
Jacob Gurevitch, MDa,
Yael Yuhas, PhDb,
Adrian Iaina, MDc,
Yoram Wollman, PhDc,
Tamara Chernichovski, MScc,
Yosef Paz, MDa,
Menachem Matsa, MDa,
Dimitri Pevni, MDa,
Amir Kramer, MDa,
Itzhak Shapira, MDa and
Rephael Mohr, MDa
a Department of Thoracic and Cardiovascular Surgery, Tel Aviv Medical Center, Tel Aviv, Israel
b Felsenstein Medical Research Center, Petah Tikva, Israel
c Department of Nephrology, Tel Aviv Medical Center, Tel Aviv, Israel
Manuscript received August 13, 1999;
revised manuscript received July 24, 2000,
accepted September 13, 2000.
Reprint requests and correspondence: Dr. Inna Frolkis, Department of Thoracic and Cardiovascular Surgery Tel Aviv Medical Center, 6 Weizman Street, Tel-Aviv 64239, Israel
 |
Abstract
|
|---|
OBJECTIVES
The purpose of this study was to explore interactions between paracrine angiotensin II (Ang-II) and tumor necrosis factor-alpha (TNF-alpha) during myocardial ischemia.
BACKGROUND
Ischemic myocardium releases significant amounts of TNF-alpha. This paracrine release correlated with postischemic myocardial injury. Other studies showed myocardial protection obtained by the use of angiotensin-converting enzyme inhibitors (i.e., captopril) and the Ang-II type 1 receptor antagonist losartan after ischemia. The possibility that these agents decrease TNF-alpha synthesis has not yet been investigated.
METHODS
Using the modified Langendorff model, isolated rat hearts underwent either 90 min of nonischemic perfusion (control group) or 1 h of global cardioplegic ischemia. In both groups, either captopril (360 µmol/liter) or losartan (182.2 µmol/liter) was added before ischemia. The hearts were assayed for messenger ribonucleic acid (mRNA) expression and effluent TNF-alpha levels. In addition, cardiac myocytes were incubated in cell culture with Ang-II.
RESULTS
After ischemia, TNF-alpha mRNA expression intensified from 0.63 ± 0.06 (control group) to 0.92 ± 0.12 (p < 0.03), and effluent TNF-alpha levels were 711 ± 154 pg/ml. The TNF-alpha mRNA expression declined to 0.46 ± 0.07 (p < 0.01) and 0.65 ± 0.08 (p < 0.02) in captopril- and losartan-treated hearts, respectively. Effluent TNF-alpha was below detectable levels. Concentrations of TNF-alpha in supernatants of incubated cardiac myocytes treated with 10 and 50 nmol/liter of Ang-II were 206.0 ± 47.0 pg/ml and 810 ± 130 pg/ml, respectively (p < 0.004). When pretreated with 700 µmol/liter of losartan, TNF-alpha was below detectable levels.
CONCLUSIONS
This study presents an original explanation for previously reported myocardial protection after ischemia, obtained by the use of captopril and losartan. These drugs reduce TNF-alpha synthesis, providing strong evidence of active interactions between paracrine TNF-alpha and Ang-II in the evolution of the ischemic cascade.
|
Abbreviations and Acronyms
| | ACE | = angiotensin-converting enzyme | | Ang-II | = angiotensin II | | cDNA | = complementary deoxyribonucleic acid | | GAPD | = glyceraldehyde-3-phosphate dehydrogenase | | LV | = left ventricular | | mAb | = monoclonal antibody | | mRNA | = messenger ribonucleic acid | | PCR | = polymerase chain reaction | | RAS | = renin-angiotensin system | | TNF-alpha | = tumor necrosis factor-alpha |
|
There is increasing evidence of the existence of an endogenous and functionally integrated renin-angiotensin system (RAS) in the heart (1,2). Intracardiac angiotensin II (Ang-II) might be involved in the regulation of coronary blood flow, the modulation of sympathetic neurotransmission and cardiac contractility, the stimulation of hyperplasia and hypertrophy and the maintenance of cardiovascular structure and repair (1,2). Angiotensin II interacts with at least two pharmacologically distinct subtypes of cell-surface receptorsAng-II type 1 and type 2 receptors (3,4). The role of the type 2 receptor is not yet well defined. The type 1 receptor mediates the major cardiovascular effects of Ang-II (5), and its messenger ribonucleic acid (mRNA) expression was found in cardiac myocytes of the human heart (6).
The role of RAS in the pathogenesis of myocardial ischemia-reperfusion injury has been postulated on the basis of the cardioprotective effects observed with angiotensin-converting enzyme (ACE) inhibitors (7). In several experimental studies, administration of Ang-II caused cardiac myocyte necrosis or induced myocardial infarction (8,9). The ACE inhibitor captopril improved the recovery of isolated rat hearts subjected to ischemia-reperfusion (10). Furthermore, high doses of the Ang-II type 1 receptor-blocking agent losartan, given in cardioplegia before ischemia, significantly improved myocardial recovery of the ischemic-reperfused isolated rat hearts (11).
Tumor necrosis factor-alpha (TNF-alpha) is a proinflammatory cytokine that has been implicated in the pathogenesis of cardiovascular diseases (1216) and myocardial ischemia-reperfusion injury (17). Significant amounts of TNF-alpha were detected in the effluent of the isolated rat hearts (18,19) having similar degrees of cardioplegic arrest and prolonged ischemia, as shown in captopril- and losartan-treated hearts. Paracrine TNF-alpha release was shown to play an important role in ischemic injury, as neutralization with specific monoclonal antibodies against this cytokine completely eliminated TNF-alpha from the effluent and concurrently attenuated the postischemic myocardial injury (20).
The purposes of this study were to examine the possible interactions between the aforementioned pathwaysAng-II and TNF-alphain the development of myocardial ischemia and to examine how captopril and losartan affect the synthesis and release of TNF-alpha in ischemic, isolated rat hearts. The effect of Ang-II on TNF-alpha production was also studied in cultured rat myocyte cells.
 |
Methods
|
|---|
Male Wistar rats were anesthetized with an intraperitoneal injection of pentobarbital sodium (30 mg/kg body weight) and heparinized. Their hearts were rapidly excised, immersed in cold saline (4°C) with heparin, mounted on the stainless-steel cannula of a modified Langendorff apparatus and perfused with Krebs-Henseleit solution exactly as described in four of our previously reported studies (10,11,18,20).
Left ventricular (LV) hemodynamic variables (peak systolic developed pressure, first derivative of rise of left ventricular pressure (dP/dtmax), time-pressure integral and coronary blood flow) were continuously recorded, and measurements were taken at 10-min intervals to confirm functional similarity of myocardial mechanical performance between different groups of isolated rat hearts.
Protocol.
Control measurements were recorded after a 15-min period of stabilization, and the hearts were assayed at this point (group A) to effluent TNF-alpha (n = 7) and LV TNF-alpha mRNA expression (n = 4). The other hearts were then perfused for a 30-min period. Effluent for TNF-alpha levels were withdrawn at this point (n = 7). Warm cardioplegia was then initiated for 2 min (37°C, perfusion pressure 73 mm Hg, 16 mEq/liter KCl in Krebs-Henseleit solution), and a 60-min period of global ischemia at 31°C was applied to the arrested hearts (group B). Other groups were similar to group B but received captopril (360 µmol/liter, group C), losartan (182.2 µmol/liter, group D) or monoclonal hamster antimurine TNF-alpha antibodies (antiTNF-alpha monoclonal antibody [mAb]) in the cardioplegic solution (0.5 µg/ml, total given dose of 15 µg, group E). Concentrations of captopril, losartan and antiTNF-alpha mAb were sufficient, in previous studies, to induce a significant improvement in postischemic LV dysfunction (10,11,20). In groups B to E, at the end of ischemia, the first milliliter of reperfusion effluent was withdrawn to determine TNF-alpha levels (n = 7 in each group). Another four or five hearts in each group (B to E) were withdrawn for LV TNF-alpha mRNA assays immediately at the end of ischemia. Group F consisted of isolated hearts undergoing a 90-min period of normal nonischemic perfusion and served as additional control group (n = 7) to postischemic TNF-alpha measurements.
Ribonucleic acid isolation and polymerase chain reaction amplification.
Immediately after 1 h of global cardioplegic ischemia, LV myocardium was excised and placed in cold Hanks balanced solution. Total RNA was extracted from myocardial samples using the guanidinium thiocyanate method (21). Pellets of RNA were kept at 20°C with 75% ethanol until assay. Dried sediments were dissolved in sterile RNAse free water and quantitized spectrophotometrically at wave length 260 nm.
Two micrograms of total RNA were subjected to reverse transcription reaction in 20 µl using a reverse transcription system (Promega). After completion of the reaction, 5 µl of this reaction mixture was used for TNF-alpha complementary deoxyribonucleic acid (cDNA) polymerase chain reaction (PCR) amplification, and 5 µl of 1:10 diluted reaction mixture was used for glyceraldehyde-3-phosphate dehydrogenase (GAPD) cDNA amplification. Our PCR negative control contained water instead of cDNA, and the cDNA negative control contained water instead of RNA. For TNF-alpha cDNA amplification, the following primers were used: senseCACGCTCTTCTGTCTACTGA; antisenseGGACTCCGTGATGTCTAAGT, producing a 546base pair (bp) fragment (22). An annealing temperature of 57°C was chosen for this reaction. For GAPG cDNA amplification, these primers were used: senseAATGCATCCTGCACCACCAA; antisenseGTAGCCATATTCATTGTCATA, producing a 515-bp fragment (23). The annealing temperature here was 60°C. The optimal cycle number for TNF-alpha was 30. For PCR amplification and reverse transcription reaction, mini-cycler TM (MJ Research Inc., Watertown, Massachusetts) was used. Similar methods were used to determine TNF-alpha mRNA expression in cultured cardiac myocytes.
Quantitative analysis.
The PCR products (10 µl) were separated in 1.8% agarose gel, stained with ethidium-bromide, visualized by ultraviolet irradiation and photographed with Polaroid film. The film was taken to evaluate band densities, using the Fujifilm Thermal Imaging System FTJ-500, computer-based Image Capture Software (Pharmacia Biotech, Jerusalem, Israel) and TINA program package (Raytest Isotope Messgerate, GmbH, Staubenhardt, Germany). The intensities of the bands were expressed in arbitrary densitometry units. All TNF-alpha band intensities were normalized by their respective GAPD values. Each PCR reaction was performed at least twice, and four or five hearts were used for each experimental group.
Determination of TNF-alpha.
Effluent samples for TNF-alpha measurements were withdrawn at baseline measurements (15' of stabilization), after 30' of perfusion (groups B to F), immediately after ischemia (first milliliter, groups B to E) and at the end of 90 min of normal nonischemic perfusion (group F) and were immediately stored at 70°C until assay. Levels of TNF-alpha were determined on the basis of cytotoxic activity bioassay on mouse L929 cells, according to the methods described by Wallach (24). Each assay included a standard curve of recombinant human TNF-alpha (specific activity 2.5 x 107 IU/mg protein; 1 IU = 40 pg TNF-alpha). The limit of detection was 40 pg/ml.
All effluent cytotoxic activity was neutralized by preincubation with antimurine TNF-alpha mAb: 33.5 ng of antibodies completely neutralized 40 pg of effluent TNF-alpha (n = 7), whereas 65.7 ng of antibodies provided 84 ± 5% of complete neutralization (n = 6, p < 0.002), thus confirming that the cytotoxic activity was caused by TNF-alpha.
Antibodies.
Hamster antimurine TNF-alpha monoclonal antibodies were purchased from Genzyme (Cambridge, Massachusetts). Specific activity: approximately 50 to 100 ng of this antibody will completely neutralize one unit of murine TNF-alpha. Monoclonal hamster antimurine TNF-alpha was previously recognized to completely neutralize rat TNF-alpha (25).
Rat cardiac myocyte cultures.
The hearts from neonatal Wistar rats (two to three days old) were removed and finely minced. The pieces were immersed in a dissociation solution (calcium- and magnesium-free Hanks balanced salt solution, Gibco, Basel, Switzerland) containing 1:200 dilution of dissociation enzyme (Institute of Biology, Nes-Ziona, Israel). One million cells were placed in 0.1% gelatin precoated, 35-mm tissue culture plates (Corning). The medium was replaced the following day. Cardiac myocyte cultures were treated with citosine arabinoside (3 mmol/liter) one day after seeding for two days to abort the multiplication of fibroblasts and other dividing cells, but with no effect on cardiac myocytes, which were essentially postmitotic. Thus, the experiments were done on highly rich cardiac myocyte cell populations (26). Using the periodic acid Schiff procedure (27), the amount of fibroblasts in the cardiac myocytes cultures never exceeded 10%.
Cardiac myocytes were treated with Ang-II on the fourth day after seeding, when the cultures were confluent. Fresh medium was introduced, and Ang-II (10 nmol/liter and 50 nmol/liter) was added for 1 h to study TNF-alpha production in the supernatant. In addition, two other groups of experiments were performed, where losartan (350 and 700 µmol/liter) was given to the cardiac myocytes as a supplement 10 min before Ang-II administration. Supernatant of untreated cardiac myocytes served as a control group.
Ethics.
All animals received humane care as described in the "Principles of Laboratory Animal Care," formulated by the National Society for Medical Research, and the "Guide for the Care and Use of Laboratory Animals," prepared by the National Academy of Sciences and published by the National Institutes of Health, Bethesda, Maryland (NIH publication no. 80-23, revised 1985).
Statistics.
Results are presented as the mean value ± SEM. The unpaired Student t test was used to assess significant differences between groups. To reveal possible differences in each of the LV hemodynamic variables in the experimental groups before cardioplegic ischemia (baseline values: 10, 20 and 30 min perfusion), two-way analysis of variance with repeated measures was performed, comparing group mean values and assessing the interaction between group and time. Significance was established at p < 0.05. All statistical analyses were performed using the SPSS computer program (SPSS Inc., Chicago, Illinois) by the Statistics Department of our medical center.
 |
Results
|
|---|
The baseline values (groups A to F) for different LV hemodynamic variables are given in Table 1. No significant differences were found between any experimental groups. Two-way analysis of variance (comparing group mean values and group-time interaction) was done to reveal possible differences in LV hemodynamic variables in the experimental groups (groups B to E) before cardioplegic ischemia (baseline values: 10, 20 and 30 min perfusion). The data are given in Table 2. None of the p values attained statistical significance.
View this table:
[in this window]
[in a new window]
|
Table 2 Left Ventricular Hemodynamic Variables of Isolated Rat Hearts Measured During the Preischemic Perfusion Period
|
|
Effect of captopril and losartan on myocardial TNF-alpha mRNA production in ischemic hearts.
The expression of mRNA for TNF-alpha was analyzed by using reverse transcription PCR primers that were shown to amplify the reverse-transcribed mRNA in rat hearts. Basal TNF-alpha mRNA expression was detected in LV specimens after a period of stabilization and did not change after a 90-min period of nonischemic perfusion (Fig. 1A). The intensities of the bands at baseline and at the end of perfusion were 0.52 ± 0.05 and 0.63 ± 0.06, respectively (p = NS) (Fig. 1B).

View larger version (44K):
[in this window]
[in a new window]
|
Figure 1 Effects of captopril and losartan on myocardial TNF-alpha mRNA expression in ischemic hearts. A, Representative PCR analysis of RNA samples (in duplicate). B, Relative optical density of TNF-alpha PCR signal. Data were normalized to relative GAPD PCR signal. Samples withdrawn at the beginning of perfusion (n = 5) (baseline) and after 90 min of normal, nonischemic perfusion (n = 4) (90' Perf) served as the control groups. In hearts undergoing global cardioplegic ischemia (n = 5), TNF-alpha mRNA expressions increased (*p < 0.03) (60' ischemia). A significant decrease in TNF-alpha mRNA expression is observed in hearts receiving either captopril (360 µmol/liter, n = 5) (Capt) or losartan (182.2 µmol/liter, n = 5) (Los) in cardioplegic solution, before ischemia. Band intensities were significantly lower than those of the ischemic group (p < 0.01 and 0.02, respectively).
|
|
After 1 h of global cardioplegic ischemia, TNF-alpha mRNA expression increased to 0.92 ± 0.12, which was significantly higher than those levels detected in nonischemic, normally perfused hearts (p < 0.03) (Fig. 1).
When either captopril (360 µmol/liter) or losartan (182.2 µmol/liter) was added to the cardioplegic solution, normalization of TNF-alpha mRNA expression was observed after 1 h of global cardioplegic ischemia (Fig. 1A). The intensities of the bands were significantly lower than those in the ischemic group, measured after 1 h of global cardioplegic ischemia (group C: 0.46 ± 0.07 [p < 0.01], group D: 0.65 ± 0.08 [p < 0.02] and group B: 0.92 ± 0.12, respectively), and there were no differences in the intensities of these bands as compared with the bands of the nonischemic, normally perfused hearts (Fig. 1B).
Effect of captopril and losartan on postischemic myocardial TNF-alpha release.
Tumor necrosis factor-alpha was not detected in the myocardial effluent after 15 min of stabilization, before ischemia (after 30 min of perfusion) and after 90 min of normal, nonischemic perfusion. Significant amounts of TNF-alpha were detected in the effluent after 1 h of global cardioplegic ischemia during the first minute of reperfusion (711 ± 154 pg/ml). When captopril (360 µmol/liter) or losartan (182.2 µmol/liter) was added to the cardioplegic solution in similar ischemic conditions, effluent TNF-alpha was below detectable levels (<40 pg/ml).
Effect of TNF-alpha depletion on myocardial TNF-alpha mRNA production.
To neutralize TNF-alpha in the ischemic heart, we added anti-TNF-alpha mAb to the cardioplegic solution. After 1 h of global ischemia in hearts treated with anti-TNF-alpha mAb, TNF-alpha mRNA expressions were at basal levels (Fig. 2A), significantly lower than those levels detected in untreated ischemic hearts (0.5 ± 0.13, p < 0.03) (Fig. 2B). Protein production of TNF-alpha in the ischemic hearts treated with anti-TNF-alpha mAB was below detectable levels.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 2 Effect of TNF-alpha depletion on myocardial TNF-alpha mRNA expression in the ischemic rat heart. A, Representative PCR analysis of RNA samples (in duplicate). B, Relative optical densities of TNF-alpha PCR signal. Data were normalized to relative GAPD PCR signal. 90' Perf = 90 min of normal nonischemic perfusion, serving as control group (n = 4); 60' Isch = hearts undergoing 1 h of global cardioplegic ischemia (n = 5); Anti TNF = hearts receiving monoclonal antiTNF-alpha antibodies in the cardioplegia (n = 5) just before ischemia, showing significantly lower TNF-alpha mRNA expression than detected in untreated ischemic hearts (*p < 0.03).
|
|
Effect of Ang-II on TNF production in rat cardiac myocyte culture.
To determine whether Ang-II can promote TNF-alpha protein production, we incubated cardiac myocyte cultures with Ang-II in concentrations of 10 and 50 nmol/liter for 1 h. Using bioassay of L929 cells, 206.0 ± 47.0 pg/ml and 810 ± 130 pg/ml of TNF-alpha were detected in the supernatants of the 10 and 50 nmol/liter Ang II, respectively (p < 0.004). In the supernatants of untreated cardiac myocyte culture, TNF-alpha was below detectable levels (Fig. 3), and the intensity of TNF-alpha mRNA bands was 1.0 ± 0.05. After 1 h of incubation with 50 nmol/liter of Ang-II, the intensity increased to 1.25 ± 0.03 (p < 0.01).

View larger version (14K):
[in this window]
[in a new window]
|
Figure 3 Effect of losartan on Ang-II-induced TNF-alpha production in rat cardiac myocyte culture. No TNF was measured in the supernatant of untreated cultures, serving as the control group (n = 5). Incubation with 10 and 50 nmol/liter of Ang-II caused significant, dose-dependent TNF-alpha release from myocytes. Preincubation with 350 or 700 µmol/liter of losartan (n = 5 in each group) decreased or abolished the observed Ang-II-induced TNF-alpha release.
|
|
When pretreated with 350 µmol/liter of losartan, the TNF-alpha concentration in the supernatants of cardiac myocytes incubated with 10 and 50 nmol/liter of Ang-II was below detectable levels and 109.3 ± 25.4 pg/ml (p < 0.006), respectively. After pretreatment with 700 µmol/liter of losartan, TNF-alpha was below detectable levels in both supernatants (Fig. 3).
 |
Discussion
|
|---|
Two mechanismsa common pathway to myocardial ischemic injury.
Angiotensin II plays a pivotal role in myocardial ischemic injury (8,9,2830). Our results suggest that the effect of Ang-II on myocardial ischemic injury is mediated by a paracrine pathway that increases synthesis and release of TNF-alpha from myocytes. This paracrine release of TNF-alpha is correlated with the postischemic deterioration of LV function (18).
Elevated TNF-alpha, a proinflammatory polypeptide hormone, has a potent negative inotropic effect (1,31,32). Recently, we (18) and others (22) found that TNF-alpha is released from ischemic hearts. In the present study, we also found an increase of TNF-alpha mRNA expression, as found by others (22,33). In our pilot study, we documented that 15 min of global ischemia was not sufficient to induce TNF-alpha synthesis and release from ischemic hearts (unpublished data).
Angiotensin II and TNF-alpha in ischemic myocardial damage.
High doses of captopril (10), an ACE inhibitor, and losartan, a specific Ang-II type 1 receptor blocker (11,34), given before ischemia, improved recovery of ischemia-reperfusion injury of isolated rat hearts. In this study, both captopril and losartan inhibited the synthesis of TNF-alpha mRNA, as well as heart perfusate effluent TNF levels. The decrease in TNF-alpha synthesis from the ischemic hearts by captopril and losartan may explain the reduction in myocardial damage (10,11).
The exact mechanism of this effect is not well established. In the current study, Ang-IIinduced TNF-alpha release from cardiac myocytes through Ang-II type 1 receptors was documented, as losartan abolished this effect.
Both TNF-alpha and Ang-II are probably linking milestones in the evolution of ischemic injury. Tumor necrosis factor-alpha is involved in the release of free radicals from the myocardium (35)a self-amplifying processas production of free radicals has been shown to further increase TNF-alpha (36). Both TNF-alpha and Ang-II act through the nitric oxide system and cause myocardial dysfunction after ischemia (37).
Anti-TNF-alpha mAb was found to prevent myocardial dysfunction during experimental burn shock (15), viral myocarditis (14) and allograft rejection (16). In this study, anti-TNF-alpha mAb prevented postischemic paracrine TNF-alpha release from the myocardium and abolished the increase of TNF-alpha mRNA expression in the ischemic hearts.
A new understanding of previous TNF-alpha immunohistochemical studies.
Immunohistochemical staining of ischemic hearts localized TNF-alpha to cardiac myocytes and, to a lesser extent, to endothelial cells of vessels (20). Immunostaining of TNF-alpha was not apparent in nonischemic, normally perfused hearts, nor in hearts pretreated with antiTNF-alpha mAb. The antibodies probably did not cross cell membranes. We therefore hypothesized (20) that antiTNF-alpha mAb binds TNF-alpha and prevents their attachment to cell membrane receptors. This might be responsible for the self-amplifying processthat is, the further increase in TNF-alpha synthesis during prolonged ischemia. A reasonable explanation for the observed cardioprotective effect of anti-TNF-alpha might be elimination of TNF-alpha from the ischemic cascade, as the entire "snowball" effect is significantly decreased, and therefore ischemic damage is also decreased. When anti-TNF-alpha antibodies were given, no increased TNF-alpha mRNA expression was found. However, factors other than TNF-alpha and Ang-II are probably important to the evolution of ischemic damage (38,39).
Conclusions.
In the present study, we found an active interaction between two important pathogenetic pathwaysparacrine TNF-alpha and paracrine Ang-IIin the evolution of myocardial ischemic cascade. Captopril, losartan and anti-TNF-alpha mAb were beneficial in ischemia-reperfusion damage of the isolated perfused hearts.
 |
Footnotes
|
|---|
This study was supported by the Research Fund of the Department of Thoracic and Cardiovascular Surgery, Sourasky Tel Aviv Medical Center.
 |
References
|
|---|
1. Baker KM, Booz GW, Dostal DE. Cardiac actions of angiotensin IIrole of an intracardiac renin-angiotensin system. Annu Rev Physiol. 1992;54:227241[CrossRef][Medline]
2. Dostal DE, Baker KM. Evidence for a role of an intracardiac renin-angiotensin system in normal and failing hearts. Trends Cardiovasc Med. 1993;3:6774
3. Bumpus FM, Catt KJ, Chiu AT, et al. Nomenclature for angiotensin receptors. Hypertension. 1991;17:720721[Free Full Text]
4. Chiu AT, Herblin WF, McCall DE, et al. Identification of angiotensin II receptor subtypes. Biochem Biophys Res Commun. 1989;165:196203[CrossRef][Medline]
5. Scott AL, Chang RSL, Lotti VJ, Siegl PKS. Cardiac angiotensin receptors, DuP and PD121981, in rabbit heart. J Pharmacol Exp Ther. 1992;261:931935[Abstract/Free Full Text]
6. Asano K, Dutcher DL, Port JD, et al. Selective downregulation of the angiotensin II AT1-receptor subtype in failing human ventricular myocardium. Circulation. 1997;96:11931200
7. Mehta PM, Pazyklenk K, Kloner RA. Cardioprotective effects of captopril in myocardial ischemia, ischemia/reperfusion and infarction. Eur Heart J. 1990;11:B94B99
8. Gavras H, Brown JJ, Lever AF, et al. Acute renal failure, tubular necrosis, and myocardial infarction. Lancet. 1971;2:1922[CrossRef][Medline]
9. Tan LB, Jalil JE, Pick R, et al. Cardiac myocyte necrosis induced by angiotensin II. Circ Res. 1991;69:11851195[Abstract/Free Full Text]
10. Gurevitch J, Pevni D, Frolkis I, et al. Captopril in cardioplegia and reperfusion: protective effects on the ischemic heart. Ann Thorac Surg. 1997;63:627633[Abstract/Free Full Text]
11. Paz Y, Gurevitch J, Frolkis I, et al. Effects of angiotensin II antagonist on ischemic and non-ischemic isolated rat heart. Ann Thorac Surg. 1998;65:474479[Abstract/Free Full Text]
12. Maury CPJ, Teppo AM. Circulating tumor necrosis factor-alpha (cachectin) in myocardial infarction. J Intern Med. 1989;225:333336[Medline]
13. Levine B, Kalman J, Mayer L, et al. Elevated circulating levels of tumor necrosis factor in severe chronic heart failure. N Engl J Med. 1990;223:236241
14. Yamada T, Matsumori A, Sasayama S. Therapeutic effect of anti-tumor necrosis factor-alpha antibody on the murine model of viral myocarditis induced by encephalomyocarditis virus. Circulation. 1994;89:846851[Abstract/Free Full Text]
15. Giroir BP, Horton JW, White J, et al. Inhibition of tumor necrosis factor prevents myocardial dysfunction during burn shock. Am J Physiol. 1994;267(1 Pt 2):H118H124
16. Imagawa DK, Millis JM, Sue P, et al. The role of tumor necrosis factor in allograft rejection. Transplantation. 1991;51:5762[Medline]
17. Caputi AP, Squadrito F. Role of tumor necrosis factor-alpha and therapeutic perspectives in bowel and myocardial ischaemia reperfusion injury. Pharmacol Res. 1992;26(Suppl 2):150151
18. Gurevitch J, Frolkis I, Yuhas Y, et al. TNF-alpha is released from the isolated heart undergoing ischemia and reperfusion. J Am Coll Cardiol. 1996;28:247252[Abstract]
19. Meldrum DR, Shames BD, Meng X, et al. Nitric oxide downregulates lung macrophage inflammatory cytokine production. Ann Thorac Surg. 1998;66:313317[Abstract/Free Full Text]
20. Gurevitch J, Frolkis I, Yuchas Y, et al. AntiTNF-alpha improves myocardial recovery following ischemia and reperfusion. J Am Coll Cardiol. 1997;30:15541561[Abstract]
21. Maniatis T, Fritsch EF, Sambrook J. Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor; 1989.
22. Herskowitz A, Choi S, Ansari AA, Wesselingh S. Cytokine mRNA expression in postischemic/reperfused myocardium. Am J Pathol. 1995;146:419428[Abstract]
23. Morrissey J, MacCracken R, Kaneto H, et al. Location of inducible nitric oxide synthase mRNA in the normal kidney. Kidney Int. 1994;45:9981005[Medline]
24. Wallach D. Preparation of lymphotoxin induce resistance to their own cytotoxic effect. J Immunol. 1984;132:24642469[Abstract]
25. Sheehan KCF, Ruddle NH, Schreiber RD. Generation and characterization of hamster monoclonal antibodies that neutralize murine tumor necrosis factors. J Immunol. 1989;142:38843893[Abstract]
26. Zangen A, Shainberg A. Thiamine deficiency in cardiac cells in culture. Biochem Pharmacol. 1997;54:575582[CrossRef][Medline]
27. Wasserman L, Kessler-Icekson G. Notes on technic: a simple method for the preparation of permanent slides from cell cultures. Stain Technol. 1984;59:353[Medline]
28. So T, Nakashima Y, Imamura M, Arakawa K. Effects of local inhibition of the cardiac renin-angiotensin system with CV-11974 in a canine ischaemia-reperfusion model. Clin Exp Pharmacol Physiol. 1998;25:503509[Medline]
29. Noda K, Sasaguri M, Ideishi M, et al. Role of locally formed angiotensin II and bradykinin in the reduction of myocardial infarct size in dogs. Cardiovasc Res. 1993;27:334340[Abstract/Free Full Text]
30. Yoshiyama M, Kim S, Yamagishi H, et al. Cardioprotective effects of the angiotensin II type 1 receptor antagonist TCV-116 on ischemia-reperfusion injury. Am Heart J. 1994;128:16[CrossRef][Medline]
31. Suffredini AF, Fromm RE, Parker MM, et al. The cardiovascular response of normal humans to the administration of endotoxin. N Engl J Med. 1989;321:280287[Abstract]
32. Yokoyama T, Vaca L, Rossen RD, et al. Cellular basis for the negative inotropic effects of tumor necrosis factor-alpha in the adult mammalian heart. J Clin Invest. 1993;92:23032312[Medline]
33. Kapadia S, Lee J, Torre-Amione G, et al. Tumor necrosis factor-alpha gene and protein expression in adult feline myocardium after endotoxin administration. J Clin Invest. 1995;96:10421052[Medline]
34. Diaz RJ, Wilson GJ. Selective blockade of AT1 angiotensin II receptors abolished ischemic preconditioning in isolated rabbit hearts. J Mol Cell Cardiol. 1997;29:129139[CrossRef][Medline]
35. Geng J, Lu J, Pan C. Effects of insulin and captopril on growth of glomerular mesangial cells in STZ-induced diabetic rats. Chung Hua I Hsueh Tsa Chih. 1996;76:4144
36. Pogrebniak HW, Matthews WA, Pass HI. Reactive oxygen species can amplify macrophage tumor necrosis factor production. Surg Forum. 1990;16:101103
37. Finkel MS, Oddis CV, Jacob TD, et al. Negative inotropic effects of cytokines on the heart mediated by nitric oxide. Science. 1992;257:387389[Abstract/Free Full Text]
38. Downey JM. Free radicals and their involvement during long term myocardial ischaemia and reperfusion. Ann Rev Physiol. 1990;52:487504[CrossRef][Medline]
39. Vane JR, Vasara H, Botting RM. Regulatory functions of the vascular endothelium. N Engl J Med. 1990;323:2736[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
A. Guggilam, K. P. Patel, M. Haque, P. J. Ebenezer, D. R. Kapusta, and J. Francis
Cytokine blockade attenuates sympathoexcitation in heart failure: Cross-talk between nNOS, AT-1R and cytokines in the hypothalamic paraventricular nucleus
Eur J Heart Fail,
July 1, 2008;
10(7):
625 - 634.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Li, J. Zimpelmann, K. Cheng, J. A. Wilkins, and K. D. Burns
The role of angiotensin converting enzyme 2 in the generation of angiotensin 1-7 by rat proximal tubules
Am J Physiol Renal Physiol,
February 1, 2005;
288(2):
F353 - F362.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Sekiguchi, X. Li, M. Coker, M. Flesch, P. M Barger, N. Sivasubramanian, and D. L Mann
Cross-regulation between the renin-angiotensin system and inflammatory mediators in cardiac hypertrophy and failure
Cardiovasc Res,
August 15, 2004;
63(3):
433 - 442.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|