cardiology careers collections past issues search home
     

J Am Coll Cardiol, 2000; 36:1579-1586
© 2000 by the American College of Cardiology Foundation
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Prasad, A.
Right arrow Articles by Quyyumi, A. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prasad, A.
Right arrow Articles by Quyyumi, A. A.

CLINICAL STUDY

The insertion/deletion polymorphism of the angiotensin-converting enzyme gene determines coronary vascular tone and nitric oxide activity

Abhiram Prasad, MBBS, MRCPa, Suresh Narayanan, MDa, Myron A. Waclawiw, PhDa, Neal Epstein, MDa and Arshed A. Quyyumi, MD, FRCP, FACCa

a Cardiology Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Maryland, USA

Manuscript received November 9, 1999; revised manuscript received April 17, 2000, accepted June 15, 2000.

Reprint requests and correspondence: Dr. Arshed A. Quyyumi, National Institutes of Health, Cardiology Branch, NHLBI, Bldg. 10, Rm. 7B15, 10 Center Dr. MSC 1650, Bethesda, Maryland 20892-1650
quyyumia{at}nih.gov


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
OBJECTIVES

We investigated whether the insertion/deletion (I/D) polymorphism in the angiotensin-converting enzyme (ACE) gene modulates vasomotor tone and endothelial function.

BACKGROUND

The deletion allele of the ACE I/D polymorphism has been associated with increased incidence of cardiovascular pathology. The risk is synergistically increased in patients who also possess the C allele at position 1,166 of the angiotensin type I (AT1) receptor gene.

METHODS

In 177 patients with coronary atherosclerosis or its risk factors, we investigated endothelial function with intracoronary acetylcholine (ACH), endothelium-independent smooth muscle function with sodium nitroprusside (SNP) and basal nitric oxide activity with L-NG monomethyl arginine.

RESULTS

Compared with ACE II genotype, patients with the ACE DD genotype had lower coronary microvascular and epicardial responses with SNP (coronary blood flow increase 196 ± 26% vs. 121 ± 11%, p = 0.003, and diameter increase 21.9 ± 2% vs. 17 ± 1%, p = 0.03, ACE II vs. DD, respectively). L-NG monomethyl arginine induced greater constriction in patients with the ACE DD compared with ACE II genotype (coronary blood flow –10 ± 4% vs. 11 ± 5%, p = 0.003, ACE DD vs. II and diameter constriction –6.3 ± 1.2% vs. –1.9 ± 1.2%, p = 0.01, respectively, in patients with atherosclerosis). No difference in ACH-mediated vasomotion was detected between the three ACE genotypes. The AT1 receptor polymorphism did not influence responses to either SNP or ACH.

CONCLUSIONS

Patients possessing the D allele of the ACE gene have increased vascular smooth muscle tone. The enhanced tone appears to be counterbalanced by an increase in basal nitric oxide activity in patients with atherosclerosis.

Abbreviations and Acronyms
  A/C = adenine/cytosine
  ACE = angiotensin-converting enzyme
  ACH = acetylcholine
  ANOVA = analysis of variance
  AT1 = angiotensin type I
  CAD = coronary artery disease
  D = deletion
  I = insertion
  L-NMMA = L-NG monomethyl arginine
  MI = myocardial infarction
  NO = nitric oxide
  PCR = polymerase chain reaction
  SNP = sodium nitroprusside


The insertion/deletion (I/D) polymorphism of the angiotensin-converting enzyme (ACE) gene has recently been identified as a possible risk factor for several cardiovascular disorders. The gene is located on chromosome 17, and the polymorphism is characterized by the presence (insertion [I]) or absence (deletion [D]) of a 287-base-pair alu repeat within intron 16. Because the polymorphism is located in an intron, it is believed to be a neutral marker in strong linkage disequilibrium with one or more unknown functional variants located in or close to the ACE gene (1,2). The three genotypes include ACE DD and II homozygotes and ID heterozygotes (3). Cambien and colleagues (4) were the first to report an increased frequency of the ACE D allele in patients with myocardial infarction (MI). They also observed a synergistic effect between the ACE D allele and the C allele of an adenine/cytosine (A/C) base substitution at position 1,166 of the angiotensin type I (AT1) receptor gene. The risk of MI appeared to be greatest in individuals with the ACE DD and AT1 receptor CC genotypes (5). Synergism between the ACE gene polymorphism and conventional risk factors such as smoking and hyperlipidemia has also been observed (6,7). Though some studies have noted the absence of an association (8–10), a recent meta-analysis confirmed that the presence of the ACE D allele was a risk factor for MI (11). Despite considerable interest in this genetic variant, few studies have explored the potential vascular mechanisms by which presence of the ACE D allele leads to these deleterious effects.

Abnormal epicardial coronary vasoconstriction and depressed microvascular dilation are early features of atherosclerosis (12,13). This results from endothelial cell dysfunction, which modulates smooth muscle function and contributes to the pathogenesis of MI and ischemia. Angiotensin-converting enzyme, a key component of the circulating and vascular renin-angiotensin systems promotes the synthesis of angiotensin II, an important regulator of vascular function (14). By stimulating the AT1 receptor, angiotensin II promotes vasoconstriction, both directly and through endothelin release or augmentation of sympathetic tone. Moreover, increased free radical generation by angiotensin II may also contribute to endothelial dysfunction (15–18). In addition, ACE also metabolizes locally synthesized bradykinin, which would promote vasoconstriction by reducing bradykinin-dependent nitric oxide (NO) release. This vasoconstriction is partly inhibited by angiotensin II–mediated release of NO from the endothelium (19–22). Because individuals with the ACE D allele have higher plasma and tissue ACE levels, we hypothesized that the D allele of the ACE gene, by increasing local angiotensin II generation and decreasing bradykinin activity, may modulate coronary vascular tone (23–27).

Thus, the aims of our study were to investigate whether the presence of the ACE D allele was: a) associated with increased smooth muscle constrictor tone tested with sodium nitroprusside (SNP), b) a determinant of basal NO activity assessed by the response to L-NG monomethyl arginine (L-NMMA) and c) a risk factor for endothelial dysfunction, as tested with acetylcholine (ACH), in both coronary conductance and resistance vessels. In view of the previous report that the ACE polymorphism was not a determinant of vasomotor function in normal subjects, we conducted this study in patients with one or more risk factors for atherosclerosis in whom there is evidence of increased tissue ACE activity (6,7,28). We also evaluated whether any association between the ACE gene polymorphism and vascular phenotype was modulated by the AT1 receptor A/C gene polymorphism.


    Methods
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Study population.   We studied patients undergoing diagnostic cardiac catheterization for investigation of chest pain or abnormal noninvasive tests. Risk factors were defined as the presence of hypertension (blood pressure > 140/90), hypercholesterolemia (low-density lipoprotein cholesterol > 160 mg/dL), diabetes, current smoking or smoking in the previous year and age >65 years. Patients with coronary artery disease (CAD) who either had atherosclerotic plaques or more severe stenoses in one or more of their coronary arteries were included in the group with atherosclerosis. Patients with recent MI, valvular heart disease or those treated with ACE inhibitors in the previous two weeks were excluded. All cardiac medications were withdrawn at least 48 h before the study, and aspirin or other cyclooxygenese inhibitors were discontinued seven days before. The study was approved by the National Heart, Lung, and Blood Institute Investigational Review Board, and informed consent was obtained from all patients.

Protocol.   After diagnostic coronary angiography was performed, a 6F guide catheter was introduced into the proximal segment of a coronary artery, and blood flow velocity was measured using a 0.018 inch wire equipped with a Doppler crystal at its tip (Cardiometrics Flowire, Cardiometrics, Endosonics Corp., Rancho Cordova, California). The Doppler flow wire was advanced into either the left main or the proximal segment of a major epicardial artery. The wire tip was carefully positioned in a segment of the vessel that was straight and free of any major branches 1 cm from the tip, that produced a characteristic and stable flow velocity signal, and that could be imaged without overlap from other vessels, thus allowing for quantitative measurements of the coronary artery diameter. Flow measurements were made in a coronary artery with <30% stenosis to ensure that microvascular function could be measured. All drugs were infused directly into the left main or the right coronary artery via the guide catheter at rates ranging between 1 and 2 ml/min. The dose of drugs administered was halved in the right coronary artery.

Study 1.   In 177 patients (92 with coronary atherosclerosis and 85 with angiographically normal coronary arteries and risk factors for atherosclerosis) we evaluated the relationship between both the ACE and AT1 receptor gene polymorphisms and the coronary vasomotor responses to ACH and SNP. After a 5-min infusion of dextrose 5% at 1 ml/min, measurement of coronary blood flow velocity and coronary angiography were performed and repeated after each intervention (13). Endothelium-dependent vasodilation was estimated by measuring coronary flow and epicardial responses to an infusion of intracoronary ACH at an estimated intracoronary concentration of 10–6 (mol/L). Ten minutes after performing the ACH measurements and repeat baseline measurements, endothelium-independent coronary smooth muscle function was estimated with intracoronary SNP given at 40 µg/min for 3 min.

Study 2.   In a subgroup of 76 patients (38 with coronary atherosclerosis and 38 with normal coronary arteries with risk factors for atherosclerosis) we evaluated the relationship between the ACE I/D polymorphism and basal NO production. Baseline measurements were made after a 10-min infusion of dextrose 5%. This was followed by a 10-min infusion of L-NMMA (Clinalfa AG, Switzerland), a specific inhibitor of NO synthesis from L-arginine, at 64 µmol/min (1 ml/min).

Measurement of coronary blood flow and diameter.   Coronary blood flow was derived from the coronary blood flow velocity and diameter measurements using the formula (pi x average peak velocity x 0.125 x diameter2) (13). Coronary vascular resistance was calculated as mean arterial pressure divided by coronary blood flow. For calculating flow, coronary artery diameter was measured in a 0.5 cm segment of vessel beginning 0.25 cm beyond the tip of the flow wire. Coronary angiograms were recorded using a cineangiographic system (Toshiba, Inc., Tustin, California), and quantitative angiography was performed with the ARTREK software (Quantim 2001, Statview, ImageComm Systems, Inc., Mountainview, California).

In addition to the measurement of the diameter at the level of the Doppler flow wire, 0.5 cm segments of mid and distal regions of the epicardial coronary arteries were also measured by quantitative coronary angiography.

Determination of ACE and AT1 receptor genotypes.   Genotyping was performed by laboratory personnel who had no knowledge of the vascular function data. Angiotensin-converting enzyme genotypes were determined by use of the polymerase chain reaction (PCR) according to previously published protocols (1). In brief, a set of primers was designed to encompass the polymorphic region in intron 16 of the ACE gene (sense primer 5' CTGGAGACCACTCCCATCCTTTCT 3' and antisense primer 5' GATGTGGCCATCACATTCGTCAGAT 3'). DNA was amplified for 35 cycles, each cycle composed of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s. The products were separated by electrophoresis on 2% agarose gel and identified by ethidium bromide staining. In order to verify the ACE DD allele, each sample found to be ACE DD was reamplified with the primers hace5a and hace5c, which recognize the inserted sequence as previously described (9). This amplification detected the presence of the I allele and produced no product from the DNA with ACE DD genotype.

The genotyping of the AT1 1,166 A/C polymorphism was accomplished by PCR amplification of a 282 bp fragment encompassing the site using a forward primer: 5' GTAAGCTCATCCACCAAGAAGCCT 3' and a reverse primer: 5'AGAAGCTCGTCGGCAGTAGACAG 3'. The A to C transversion creates a Dde 1 restriction enzyme site that, upon digestion, yields two fragments of 148 and 134 bps. The PCR amplification protocol was as above, but the digested products were resolved on a 10% acrylamide gel.

Statistical analysis.   Data are expressed as mean ± SEM. Differences between means were compared by paired or unpaired Student t test, as appropriate. All p values were two-tailed, and a value <0.05 was considered to indicate statistical significance. Univariate comparisons between the responses in patients with the ACE DD, ID and II genotypes and AT1 AA, AC and CC genotypes were performed using analysis of variance (ANOVA). To identify the most parsimonious multivariate model for predicting changes in coronary blood flow for each of SNP, ACH and L-NMMA, we used the SAS Stepwise Procedure (stepwise technique) on the regressors age, hypertension, diabetes, cigarette use, total cholesterol level, high-density lipoprotein level, presence of coronary atherosclerosis and the ACE gene polymorphism (DD, ID or II). The significance level for covariate entry and staying in the model was 0.15. The three genotypes were defined with two dummy variables, as opposed to defining them as one variable with three different levels, to avoid the assumption of a linear relationship between genotypes and the response. The GLM Procedure of SAS was then applied to the final model to facilitate a global test for the equality of the three genotype effects as well as Bonferroni pairwise comparisons of the three genotypes where significance was noted on the global test.


    Results
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Study 1.   The frequencies of the ACE D and I alleles were 57% and 43%, respectively, and the AT1 receptor A and C alleles were 77% and 23%, respectively. These frequencies were similar to those reported in previous studies (4,5,28), and the genotype frequency did not deviate significantly from that predicted by the Hardy–Weinberg equilibrium. There were 102 (58%) men; mean age was 55 ± 1 years; 67 (38%) were hypertensive; 106 (60%) were current or previous smokers; 29 (16%) had diabetes; and the mean cholesterol level was 221 ± 3 mg/dL. As reported previously, ACE levels were significantly higher in patients with the D allele (23). The distribution of conventional risk factors for atherosclerosis and endothelial dysfunction was similar between the three groups of patients (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1 Patient Characteristics for Each Genotype

 
Genotype and coronary vascular response to SNP.   Baseline systemic blood pressure, coronary epicardial diameter and vascular resistance were similar in patients with all three ACE and AT1 receptor genotypes (Table 2). Sodium nitroprusside infusion reduced mean arterial pressure from 110 ± 1 to 103 ± 1 mm Hg (p < 0.001), but the change was not significantly different between the genotype groups. There was a progressive decrease in coronary epicardial and microvascular responses to SNP in the presence of the ACE D allele, with the lowest response in patients homozygous for the D allele, intermediate response in those with the ACE ID genotype and greatest response in those homozygous for the I allele (p < 0.003 for flow and p = 0.085 for diameter by ANOVA, Fig. 1). Thus, compared with patients with the ACE DD genotype, those with ACE II genotype had greater increase in flow (196 ± 26% vs. 121 ± 11%, p = 0.003) and diameter (21.9 ± 2% vs. 17 ± 1%, p = 0.03) with SNP. In multivariate analysis, the presence of the ACE D allele (p = 0.007) and diabetes mellitus (p = 0.04) were independent predictors of the magnitude of increase in coronary blood flow with SNP.


View this table:
[in this window]
[in a new window]
 
Table 2 Baseline Coronary and Systemic Hemodynamics

 


View larger version (37K):
[in this window]
[in a new window]
 
Figure 1 Effects of acetylcholine and sodium nitroprusside on coronary vascular resistance, coronary blood flow and epicardial diameter according to angiotensin-converting enzyme genotype.

 
The responses to SNP in patients with AT1 AA, AC and CC genotypes were similar (Fig. 2, Table 3). The analysis for the interaction between the two polymorphisms was performed in patients with the D allele of the ACE gene. There was no difference in the responses in individuals with the ACE D allele (DD or ID) who were homozygous for the A allele when compared to those possessing the C allele (AC and CC genotypes) of the AT1 receptor gene (Table 3).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 2 Effects of acetylcholine and sodium nitroprusside on coronary vascular resistance, coronary blood flow and epicardial diameter according to angiotensin type I receptor genotype.

 

View this table:
[in this window]
[in a new window]
 
Table 3 Coronary Epicardial and Microvascular Responses According to the AT1 Receptor Gene Polymorphism

 
Genotype and coronary vascular response to ACH.   Acetylcholine 10–6 moles/L infusion did not alter the mean arterial pressure. Coronary vascular responses to ACH were similar in patients with the ACE DD, ID and II genotypes (p > 0.1 for flow and diameter changes, Fig. 1). Because smooth muscle reactivity differed between subgroups, we also analyzed the response to ACH as a ratio of the response to SNP. The ratio of the coronary blood flow increase with ACH compared with the increase with SNP was 1.1 ± 1, 1.0 ± 0.1 and 0.9 ± 0.1 in the ACE DD, ID and II genotypes, respectively (p = NS, by ANOVA). Similarly, the ratio of ACH versus SNP responses in the epicardial coronary arteries were not significantly different.

The responses to ACH were also not different in patients with the AT1 AA, AC and CC genotypes (Table 3, Fig. 2). An analysis for the interaction between the two polymorphisms, as described for SNP, was also performed for ACH responses, and no difference was found (Table 3).

Study 2: genotype and coronary vascular response to L-NMMA.   The frequencies of the D and I alleles were 52% and 48%, and the frequencies of the ACE DD, ID and II genotypes were 29%, 46% and 25%, respectively, in this subgroup. Genotype frequency did not deviate significantly from that predicted by the Hardy–Weinberg equilibrium. Baseline systemic and coronary hemodynamics and the distribution of conventional risk factors for endothelial dysfunction were similar in patients with all three genotypes (Table 2).

L-NG monomethyl arginine infusion increased mean arterial pressure from 110 ± 2 to 117 ± 2 mm Hg (p < 0.001) in the total study population, and the magnitude of increase was similar in the three genotype subsets. The increase in coronary vascular resistance and the reduction in blood flow with L-NMMA was greater in patients with the ACE D allele (p = 0.07, by ANOVA for both, Fig. 3). Thus, the –7 ± 3% reduction in coronary blood flow in the ACE DD patients was higher than the ACE II patients in whom blood flow changed by 5 ± 4%, p = 0.003. Patients with the ACE ID genotype had an intermediate response. In multivariate analysis, the presence of the ACE D allele (p = 0.08) appeared to be a predictor of the magnitude of change in coronary blood flow with L-NMMA.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 3 Effects of L-NG monomethyl arginine (L-NMMA) on coronary vascular resistance, coronary blood flow and epicardial diameter according to angiotensin-converting enzyme genotype.

 
Although the trend toward a decreased epicardial response to L-NMMA in patients with the ACE II genotype did not reach statistical significance compared with those with the ACE DD genotype in the whole group (Fig. 3), this difference was significant in the subgroup of 37 patients with angiographic atherosclerosis in whom epicardial diameter decreased by 6.3 ± 1.2%, 5.0 ± 1.4% and 1.9 ± 1.2% in ACE DD, ID and II genotypes, respectively (p = 0.04, by ANOVA).


    Discussion
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
To obtain insights into mechanisms underlying the association between the D allele and increased prevalence of vascular disease, we examined the effects of the ACE gene polymorphism on coronary endothelial and smooth muscle function. Endothelial function was studied using both L-NMMA, to estimate basal NO activity, and ACH, to estimate endothelial function upon pharmacologic stimulation. Smooth muscle function was assessed using an endothelium-independent dilator, SNP. Our study demonstrates that the presence of the ACE D allele: a) is associated with depressed vasodilation with SNP denoting increased vascular smooth muscle tone; b) is associated with enhanced vasoconstriction with L-NMMA confirming increased basal NO activity; and c) does not influence ACH responses, indicating that the ACE genotype may not be a determinant of stimulated endothelial function in the coronary circulation of patients with atherosclerosis or one of its risk factors. Furthermore, the 1,166 A/C AT1 receptor gene polymorphism does not influence coronary vascular endothelial or smooth muscle function.

ACE deletion allele and basal constrictor tone.   A significant reduction in the dilator response of microvessels and epicardial arteries with SNP, a NO donor that directly stimulates smooth muscle production of cyclic guanylate monophosphate, was observed in patients with the D allele, compared with those with the ACE II genotype. This reduced vasodilation with SNP may reflect enhanced smooth muscle constrictor tone due to higher angiotensin II and lower bradykinin activity (25,27,29,30) in blood vessels of patients with the ACE D allele who have increased circulating and tissue ACE levels (23,24). In addition, these patients may also have increased smooth muscle constrictor tone due to angiotensin II–mediated endothelin release and stimulation of sympathetic activity (15,16). Since this increased smooth muscle constrictor tone in patients with the D allele was not associated with increased resting coronary vascular resistance and smaller epicardial diameters, it is likely that counter–regulatory endogenous release of dilating substances, possibly endothelium-derived, is also upregulated in these patients. This possibility is supported by our observation that basal NO activity was higher in individuals with the D allele.

D allele and basal NO activity.   Presence of the ACE D allele was associated with greater microvascular and epicardial constriction with L-NMMA compared with those with the ACE II genotype. This may be a consequence of higher basal NO activity and/or increased vasoconstrictor tone in the coronary vasculature of individuals with the ACE D allele. The former mechanism is supported by a previous in vitro study in which higher basal NO activity was present in internal mammary artery segments from patients with CAD who possessed the ACE D allele (26). Furthermore, this is analogous to the recent finding that a high lipoprotein(a) level, another risk factor for cardiovascular disease, is associated with increased basal NO release (31). It is important to recognize that the variable stimulation of basal NO activity occurred despite the presence of multiple risk factors that are themselves associated with reduced NO activity (13). Multivariate analysis of determinants of basal NO activity (L-NMMA response) demonstrated that the ACE D allele tended to be an independent determinant of the L-NMMA response in the coronary microvasculature. This emphasizes the important additional role of the D genotype and, hence, tissue ACE activity on NO bioavailability. The mechanisms underlying this observation may be explained by the fact that angiotensin II itself stimulates NO release. Angiotensin II promotes NO release in a dose-dependent manner by activating NO synthase either via the AT1 or AT2 receptor stimulation (19,20,22). This raises the possibility that activation of the tissue renin-angiotensin system in atherosclerosis (32) may also regulate basal NO activity in humans so that greater angiotensin II activity in individuals with the ACE D allele would be expected to lead to higher basal NO release.

Alternatively, it is also likely that the greater response to L-NMMA may be due to the increased smooth muscle tone in patients with the D allele, as suggested by the diminished vasodilator response to SNP as discussed above. The lack of difference in basal coronary vascular tone in patients with different ACE I/D genotypes leads us to speculate that the increased smooth muscle tone is offset by increased production of endogenous vasodilators such as NO.

ACE D allele and stimulated endothelial function.   Endothelial dysfunction is characterized by depressed microvascular and epicardial dilation in response to pharmacologic probes including ACH (13). In our study ACH-mediated microvascular and epicardial vasomotion was similar in all three genotype groups, indicating that the ACE gene polymorphism does not modulate endothelium-dependent vasomotor dysfunction in patients with one or more risk factors for atherosclerosis. Because smooth muscle tone as assessed by SNP, an NO donor, was increased in patients with the ACE D allele, it is important to interpret the unchanged response with ACH, that releases NO via the endothelium, in this population with caution. We therefore analyzed the response to ACH as a ratio of the response to SNP and found no statistical difference between the groups, confirming that stimulated endothelium-dependent vasomotion was not different between the groups. An explanation as to why the response to ACH is unaltered when the response to an endothelium-independent NO donor, SNP, is reduced in patients with the D allele may be that these patients had enhanced stimulated NO release. This possibility is consistent with the observed increase in basal NO activity. Alternatively, there may be increased release non–NO endothelium-derived relaxing factors in response to ACH, a release that compensates for the increased smooth muscle tone in patients with the ACE D allele.

Our findings are consistent with a previous study in individuals without risk factors for atherosclerosis in whom the ACE gene polymorphism also did not determine endothelial function, which was assessed by brachial artery dilation during reactive hyperemia (28). However, a recent study reported that individuals with the ACE DD genotype had higher plasma PAI-1 levels, von Willebrand factor and thrombomodulin, all markers of endothelial dysfunction (33,34). This raises the possibility that the ACE gene polymorphism may impair functions of the endothelium that are independent of factors that control vasomotion.

AT1 receptor polymorphism and vasomotor function.   In our study the A/C polymorphism of the angiotensin AT1 receptor gene did not influence endothelial or smooth muscle function either directly or in synergy with the ACE gene. Because of the low frequency of the C allele, we were unable to determine the influence of this polymorphism on basal NO activity. Though the polymorphism has been previously associated with enhanced coronary vasoconstriction with methylergonovine (35), our data suggest that the receptor polymorphism is not a major determinant of vasomotor function in patients with atherosclerosis or its risk factors. This conclusion is consistent with the fact that the genetic variant is: a) located in the noncoding region and thus does not alter the amino acid sequence of the receptor protein, b) not a direct risk factor for coronary artery disease and c) only a weak risk factor for hypertension (5,36).

Study limitations.   Although we did not evaluate the vasomotor responses to bradykinin here, in a subsequent study we observed that epicardial dilation with bradykinin is diminished in individuals with the ACE D allele compared with those with the II genotype (37). Together with the present study, these data indicate that the ACE gene polymorphism modulates kinin but not muscarinic receptor mediated endothelial function. We did not investigate the interaction between the presence of the ACE D allele and individual risk factors for CAD in determining vascular function, because of the limited and selected population. We also did not investigate whether the ACE I/D polymorphism affected other functions of the endothelium, such as adhesion molecule expression, lipid oxidation and PAI-1 synthesis, which are all sensitive to angiotensin II. It is possible that the deleterious effects of the D allele in the ACE gene and the C allele of the AT1 receptor gene may be mediated through one or more of these mechanisms.

Conclusions and implications.   For the first time, to our knowledge, we demonstrated the influence of a patient’s genotype on coronary vasomotor function, which reveals the complex inter-relationships between vasoconstrictors and vasodilators and activation of compensatory pathways. We show that in patients with either atherosclerosis or its risk factors, the D allele of the ACE gene is associated with greater basal NO activity, possibly in compensation for the increased vascular smooth muscle tone, which may be secondary to increased local angiotensin II and reduced bradykinin activities. Thus, the ACE I/D polymorphism may predispose to hypertension, MI and coronary artery spasm (37) (ref. 37 published in this issue of the Journal), not by inducing endothelial injury but by promoting smooth muscle vasoconstriction. This conclusion is supported by the recent observation that individuals with the ACE DD genotype have greater systemic constrictor response to phenylepherine and increased angiotensin II–induced potentiation of phenylepherine-mediated constriction of arterial segments in vitro compared with those with the ACE ID/II genotypes (39). Finally, the AT1 receptor A/C polymorphism is not a determinant of coronary vasomotor function and does not modulate the effects of the ACE genotype on the vascular phenotype. (38)


    Acknowledgments
 
We are grateful to Gloria Zalos, RN, William H. Schenke, B.S., and Rita Mincemoyer, RN, for their technical assistance.


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 

  1. Tiret L, Rigat B, Visvikis S, et al. Evidence, from combined segregation and linkage analysis, that a variant of the angiotensin I-converting enzyme (ACE) gene controls plasma ACE levels. Am J Hum Genet. 1992;51:197–205[Medline]
  2. Villard E, Tiret L, Visvikis S, Rakotovao R, Cambien F, Soubrier F. Identification of new polymorphisms of the angiotensin I-converting enzyme (ACE) gene, and study of their relationship to plasma ACE levels by two-QTL segregation-linkage analysis. Am J Hum Genet. 1996;58:1268–1278[Medline]
  3. Villard E, Soubrier F. Molecular biology and genetics of the angiotensin I-converting enzyme: potential implications in cardiovascular diseases. Cardiovasc Res. 1996;32:999–1007[Free Full Text]
  4. Cambien F, Poirier O, Lecerf L, et al. Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature. 1992;359:641–644[CrossRef][Medline]
  5. Tiret L, Bonnardeaux A, Poirier O, et al. Synergistic effects of angiotensin-converting enzyme and angiotensin-II type 1 receptor gene polymorphisms on risk of myocardial infarction. Lancet. 1994;344:910–913[CrossRef][Medline]
  6. Hibi K, Ishigami T, Kimura K, et al. Angiotensin-converting enzyme gene polymorphism adds risk for the severity of coronary atherosclerosis in smokers. Hypertension. 1997;30:574–579[Abstract/Free Full Text]
  7. O’Malley JP, Maslen CL, Illingworth R. Angiotensin-converting enzyme DD genotype and cardiovascular disease in heterozygous familial hypercholesterolemia. Circulation. 1998;97:1780–1783[Abstract/Free Full Text]
  8. Friedl W, Krempler F, Paulweber B, Pichler M, Sandhofer F. A deletion polymorphism in the angiotensin converting enzyme gene is not associated with coronary heart disease in an Austrian population. Atherosclerosis. 1995;112:137–143[CrossRef][Medline]
  9. Lindpaintner K, Pfeffer MA, Kreutz R, et al. A prospective evaluation of an angiotensin-converting enzyme gene polymorphism and the risk of ischemic heart disease. N Engl J Med. 1995;332:706–711[Abstract/Free Full Text]
  10. Agerholm-Larsen B, Nordestgaard BG, et al. Angiotensin-converting enzyme gene polymorphism: ischemic heart disease and longevity in 10,150 individuals. A case-referent and retrospective cohort study based on the Copenhagen City Heart Study. Circulation. 1997;95:2358–2367[Abstract/Free Full Text]
  11. Samani NJ, Thompson JR, O’Toole L, Channer K, Woods KL. A meta-analysis of the association of the deletion allele of the angiotensin-converting enzyme gene with myocardial infarction. Circulation. 1996;94:708–712[Abstract/Free Full Text]
  12. Ludmer PL, Selwyn AP, Shook TL, et al. Paradoxical vasoconstriction induced by acetylcholine in atherosclerotic coronary arteries. N Engl J Med. 1986;315:1046–1051[Abstract]
  13. Quyyumi AA, Dakak N, Andrews NP, et al. Nitric oxide activity in the human coronary circulation. J Clin Invest. 1995;95:1747–1755[Medline]
  14. Rosendorff C. The renin-angiotensin system and vascular hypertrophy. J Am Coll Cardiol. 1996;28:803–812[Abstract]
  15. Dohi Y, Hahn AWA, Boulanger CM, Bühler FR, Lüscher TF. Endothelin stimulated by angiotensin II augments contractility of spontaneously hypertensive rat arteries. Hypertension. 1992;19:131–137[Abstract/Free Full Text]
  16. Seidelin PH, Collier JG, Webb DJ. Angiotensin II augments sympathetically mediated arteriolar constriction in man. Clin Sci. 1991;81:261–266[Medline]
  17. Rajagopalan S, Kurz S, Münzel T, et al. Angiotensin II-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/NADPH oxidase activation. J Clin Invest. 1996;97:1916–1923[Medline]
  18. Griendling K, Ollerenshaw JD, Minieri CA, Alexander RW. Angiotensin II stimulates NADH and NADPH activity in cultured vascular smooth muscle cells. Circ Res. 1994;74:1141–1148[Abstract/Free Full Text]
  19. Boulanger CM, Caputo L, Levy BI. Endothelial AT1-mediated release of nitric oxide decreases angiotensin II contractions in rat carotid artery. Hypertension. 1995;26:752–757[Abstract/Free Full Text]
  20. Saito S, Hirata Y, Emori T, Imai T, Marumo F. Angiotensin II activates endothelial constitutive nitric oxide synthase via AT1 receptors. Hypertens Res. 1996;19:201–206[Medline]
  21. Andriantsitohaina R, Okruhlicova L, de Franca Cortes S, et al. Role of endothelial nitric oxide in the response to angiotensin II of small mesenteric arteries of the rat. J Vasc Res. 1996;33:386–394[Medline]
  22. Siragy HM, Carey RM. The subtype 2 (AT2) angiotensin receptor mediates renal production of nitric oxide in conscious rats. J Clin Invest. 1997;100:264–269[Medline]
  23. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest. 1990;86:1343–1346[Medline]
  24. Danser AH, Schalekamp MA, Bax WA, et al. Angiotensin-converting enzyme in the human heart. Effect of the deletion/insertion polymorphism. Circulation. 1995;92:1387–1388[Abstract/Free Full Text]
  25. Ueda S, Elliott HL, Morton JJ, Connell JM. Enhanced pressor response to angiotensin I in normotensive men with the deletion genotype (DD) for angiotensin-converting enzyme. Hypertension. 1995;25:1266–1269[Abstract/Free Full Text]
  26. Buikema H, Pinto YM, Rooks G, Grandjean JG, Schunkert H, van Gilst WH. The deletion polymorphism of the angiotensin-converting enzyme gene is related to phenotypic differences in human arteries. Eur Heart J. 1996;17:787–794[Abstract/Free Full Text]
  27. Brown NJ, Blais C, Gandhi SK, Adam A. ACE insertion/deletion genotype affects bradykinin metabolism. J Cardiovasc Pharmacol. 1998;32:373–377[CrossRef][Medline]
  28. Celermajer DS, Sorensen KE, Barley J, Jeffrey S, Carter N, Deanfield J. Angiotensin-converting enzyme genotype is not associated with endothelial dysfunction in subjects without other coronary risk factors. Atherosclerosis. 1994;111:121–126[CrossRef][Medline]
  29. Bhoola KD, Figueroa CD, Worhty K. Bioregulation of kinins, kallikreins, kininogens, and kiniases. Pharmacol Rev. 1992;44:1–80[Medline]
  30. Groves P, Kurz S, Just H, Drexler H. Role of endogenous bradykinin in human coronary vasomotor control. Circulation. 1995;92:3424–3430[Abstract/Free Full Text]
  31. Schlaich MP, John S, Langenfeld MR, Lackner KJ, Schmitz G, Schmieder RE. Does lipoprotein(a) impair endothelial function? J Am Coll Cardiol. 1998;31:359–365[Abstract/Free Full Text]
  32. Diet F, Pratt RE, Berry GJ, Momose N, Gibbons GH, Dzau VJ. Increased accumulation of tissue ACE in human atherosclerotic coronary artery disease. Circulation. 1996;94:2756–2767[Abstract/Free Full Text]
  33. Kim DK, Kim JW, Kim S, et al. Polymorphism of angiotensin-converting enzyme gene is associated with circulating levels of plasminogen activator inhibitor-1. Arterioscler Thromb Vasc Biol. 1997;17:3242–3247[Abstract/Free Full Text]
  34. Kario K, Matsuo T, Kobayashi H, et al. Endothelial cell damage and angiotensin-converting enzyme insertion/deletion genotype in elderly hypertensive patients. J Am Coll Cardiol. 1998;32:444–450[Abstract/Free Full Text]
  35. Amant C, Hamon M, Bauters C, et al. The angiotensin II type-1 receptor gene polymorphism is associated with coronary artery vasoconstriction. J Am Coll Cardiol. 1997;29:486–490[Abstract]
  36. Bonnardeaux A, Davies E, Jeunemaitre X, et al. Angiotensin II type-1 receptor gene polymorphisms in human essential hypertension. Hypertension. 1994;24:63–69[Abstract/Free Full Text]
  37. Prasad A, Husain S, Schenke W, Mincemoyer R, Epstein N, Quyyumi AA. Contribution of bradykinin B2 receptor dysfunction to abnormal coronary vasomotion in humans. J Am Coll Cardiol. 2000;36:1467–1473[Abstract/Free Full Text]
  38. Henrion D, Benessiano J, Philip I, et al. The deletion genotype of the angiotensin I-converting enzyme is associated with an increased vascular reactivity in vivo and in vitro. J Am Coll Cardiol. 1999;34:830–836[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Vasc MedHome page
J. W Olin
Masterclass series in peripheral arterial disease: Hypertension and peripheral arterial disease
Vascular Medicine, August 1, 2005; 10(3): 241 - 246.
[PDF]


Home page
HeartHome page
S Gulec, O Aras, Y Atmaca, O Akyurek, N Q Hanson, T Sayin, M Y Tsai, N Akar, and D Oral
Deletion polymorphism of the angiotensin I converting enzyme gene is a potent risk factor for coronary artery ectasia
Heart, February 1, 2003; 89(2): 213 - 214.
[Full Text] [PDF]


Home page
J Am Coll CardiolHome page
S. Kennon, K. Barakat, G. A. Hitman, C. P. Price, P. G. Mills, K. Ranjadayalan, J. Cooper, H. Clark, and A. D. Timmis
Angiotensin-converting enzyme inhibition is associated with reduced troponin release in non-ST-elevation acute coronary syndromes
J. Am. Coll. Cardiol., September 1, 2001; 38(3): 724 - 728.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
A. Prasad, S. Husain, W. Schenke, R. Mincemoyer, N. Epstein, and A. A. Quyyumi
Contribution of bradykinin receptor dysfunction to abnormal coronary vasomotion in humans
J. Am. Coll. Cardiol., November 1, 2000; 36(5): 1467 - 1473.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Prasad, A.
Right arrow Articles by Quyyumi, A. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prasad, A.
Right arrow Articles by Quyyumi, A. A.

 
  cardiology careers collections past issues search home