Submit Manuscripts
Author Information
Subscribe/Renew
Email Alerts
Feedback
RSS Feed

About the Journal
Editorial Board & Staff

Interventions Homepage Imaging Homepage Interventions Homepage Imaging Homepage

ACC.org
Cardiosmart
Cardiosource
CVN
Imaging Library
JACC Imaging
JACC Interventions


2009 Appropriateness Criteria for Coronary Revascularization

Intensive Glycemic Control and the Prevention of Cardiovascular Events: Expert Consensus Document
cardiology careers collections past issues search home
     

J Am Coll Cardiol, 2000; 36:635-642
© 2000 by the American College of Cardiology Foundation
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iwanaga, Y.
Right arrow Articles by Sasayama, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iwanaga, Y.
Right arrow Articles by Sasayama, S.

EXPERIMENTAL STUDIES

Modulation of in vivo cardiac hypertrophy with insulin-like growth factor-1 and angiotensin-converting enzyme inhibitor: relationship between change in myosin isoform and progression of left ventricular dysfunction

Yoshitaka Iwanaga, MD, PhDa, Yasuki Kihara, MD, PhD, FACCa, Takeshi Yoneda, MDa, Takeshi Aoyama, MD, PhDa and Shigetake Sasayama, MD, PhD, FACCa

a Department of Cardiovascular Medicine, Kyoto University Graduate School of Medicine, Kyoto, Japan

Manuscript received March 8, 1999; revised manuscript received February 16, 2000, accepted April 5, 2000.

Reprint requests and correspondence: Dr. Yasuki Kihara, Department of Cardiovascular Medicine, Kyoto University Graduate School of Medicine, 54 Shogoin Kawaharacho, Sakyo-ku, Kyoto 606-8507, Japan
kihara{at}kuhp.kyoto-u.ac.jp


   Abstract
Top
 Abstract
Materials and methods
 Results
 Discussion
 References
 
OBJECTIVES

Supplemental myocardial hypertrophy induced by insulin-like growth factor (IGF)-1 may prevent transition from hypertrophy to heart failure under chronic mechanical overload.

BACKGROUND

Several studies have suggested that IGF-1 treatment may be beneficial in chronic heart failure. In addition, recent studies indicated that the amount of {alpha}-myosin heavy chain (MHC) plays a significant hemodynamic role in large animals including humans.

METHODS

We treated Dahl salt-sensitive hypertensive rats on a long-term basis with IGF-1. The effects were compared with those produced by treatment using a sub-antihypertensive dose of temocapril, an angiotensin-converting enzyme (ACE) inhibitor. At 11 weeks, when these rats displayed compensated left ventricular hypertrophy (LVH), they were randomized to three groups: 1) IGF group (3 mg/kg/day); 2) temocapril group (1 mg/kg/day); and 3) vehicle (control) group.

RESULTS

After 15 weeks, the control rats showed left ventricular (LV) enlargement and severe LV dysfunction and rapidly died of pulmonary congestion (mean survival time: 16.8 ± 0.5 weeks). The survival time was significantly shortened (15.6 ± 0.3 weeks) in the IGF-1 group but significantly prolonged (19.5 ± 0.6 weeks) in the temocapril group. The rats in the IGF-1 group showed accelerated LV dilation and dysfunction. Of the several parameters investigated, it was found that the relative amounts of MHC isoforms differed among the three groups. The {alpha}-MHC mRNA level was decreased by 52% (p < 0.01) in the IGF group, while it increased by 58% (p < 0.01) in the temocapril group compared with the control group. These changes were related to the progression of LV dysfunction.

CONCLUSIONS

Supplemental myocardial hypertrophy with long-term IGF-1 treatment may not be beneficial if concentric LVH already exists. Our data suggest that IGF-1 may not protect myocardial performance when its hypertrophic effect aggravates the reduction of {alpha}-MHC. By contrast, the ACE inhibitor may improve myocardial function and prognosis by preventing the down-regulation of this isoform.

Abbreviations and Acronyms
  ACE = angiotensin-converting enzyme
  AT-II = angiotensin-II
  DS = Dahl salt-sensitive
  FS = fractional shortening
  GAPDH = glyceraldehyde-3-phosphate dehydrogenase
  GH = growth hormone
  IGF = insulin-like growth factor
  LVH = left ventricular hypertrophy
  MHC = myosin heavy chain
  RWT = relative wall thickness
  SERCA = sarcoplasmic reticulum Ca2+ ATPase

Myocardial hypertrophy is an adaptive response to various mechanical and hormonal stimuli, but it also represents an initial step in the pathogenesis of many cardiac diseases that ultimately progress to ventricular failure. The mechanisms by which this condition eventually progresses to heart failure are not fully understood (1). Several drugs such as angiotensin-converting enzyme (ACE) inhibitors (2), beta-blockers (3), and endothelin receptor blockers (4) have been clinically introduced to prevent the progression to heart failure. All of these drugs act to suppress excessive neurohumoral stimuli. However, their effects are limited, and mortality and morbidity in heart-failure patients still remain unacceptably high.

Insulin-like growth factor (IGF)-1, a 70 amino-acid basic peptide, is an essential growth factor for somatic-cell proliferation and differentiation during development, mediating the biological effects of growth hormone (GH) (5,6). The IGF-1 also acts in an autocrine or paracrine manner on myocyte growth and hypertrophy. Several studies have suggested that GH or IGF-1 treatment may be beneficial in chronic heart failure, and they have offered the possibility that insufficient myocardial hypertrophy might be the trigger mechanism for the transition to heart failure. In experimental studies, GH or IGF-1 administration has brought about improved hemodynamic profiles in heart-failure animals due to myocardial infarction (7,8). In a study of GH treatment in patients with dilated cardiomyopathy, Fazio et al. (9) showed favorable effects on cardiac function and exercise capacity that corresponded to an increase in the IGF-1 levels. In contrast, recent prospective randomized trials have failed to demonstrate substantial benefits of GH treatment (10). Therefore, it is currently controversial whether or not GH or IGF-1 administration can offer therapeutic benefits in treating heart failure, and it is also unclear what forms of heart failure these drugs may optimally benefit (11). Further, the mechanism by which GH or IGF-1 acts in failing myocardial tissues remains poorly understood.

To address such questions, we utilized salt-sensitive hypertensive rats in which the process from mechanically compensated left ventricular hypertrophy (LVH) to heart failure can be clearly observed (12–14). We investigated the cardiovascular effects of chronic IGF-1 administration on the cardiac geometry and function as well as the prognosis in these animals. In addition, by comparing these effects with those of an ACE inhibitor, we found that the qualitative modulation rather than the quantitative supply of contractile proteins may be crucial for myocardial performance and animal prognosis in transition to heart failure.


   Materials and methods
Top
 Abstract
 Materials and methods
Results
 Discussion
 References
 
Experimental animals and general protocols.   In all, 46 male inbred Dahl salt-sensitive (DS) rats were used for the experiments. They were obtained from Eisai Co. (Tokyo, Japan) and were fed an 8% NaCl (high-salt) diet after six weeks of age (15,16). As described previously, these DS rats develop systemic hypertension and show concentric LVH at the age of 11 weeks. At the subsequent age of 16 to 18 weeks, the DS rats showed LV dilation and global hypokinesis and died of massive pulmonary congestion within a week (12).

The 11-week LVH-DS rats were randomized into three groups: those treated with recombinant human IGF-1 (rhIGF-1; Fujisawa Co., Osaka, Japan) at a daily dose of 3 mg/kg body weight (IGF-1 group); those treated with temocapril hydrochloride, an ACE inhibitor (Sankyo Co., Tokyo, Japan) (17), of 1 mg/kg body weight/day (temocapril group); or those treated with vehicle alone (control group). The IGF-1 was dissolved in normal saline and was administrated via a subcutaneous-implanted osmotic mini-pump (model 2ML4, Alzet, Newark, Delware). Temocapril was dissolved in distilled water containing 1% NaHCO3 and orally administrated once a day. In the control group, normal saline (with no IGF-1) was continuously infused in the same manner as in the IGF-1 group. In a preliminary study, the subcutaneous pump implantation did not affect echocardiographic findings or survival.

In the first protocol (n = 8 in the IGF-1 group, and n = 10 in the temocapril and control groups) the animals were monitored on a day-by-day basis to assess their survival. The body weight (BW), tail-cuff systolic blood pressure (SBP), and the in vivo echocardiographic assessment of LV dimensions and contraction were performed biweekly (12). The relative wall thickness (RWT), the LV fractional shortening (FS), and the LV mass were estimated from the values of LV end-diastolic diameter (EDD), end-systolic diameter (ESD), and end-diastolic posterior wall thickness (PWT) as described previously (18). In the second protocol (n = 6 in each group), at the age of 15 weeks (4 weeks after the initiation of drug treatment), the rats were deeply anesthetized with sodium pentobarbital. The LV was rapidly excised, frozen in liquid nitrogen, and stored at –80°C until use.

IGF-1 radioimmunoassay.   At 15 weeks, before sacrificing the animals, blood samples were collected in a heparinized syringe and centrifuged, and the plasma was obtained and stored at –20°C before analysis. Serum rhIGF-1 levels were measured by radioimmunoassay (RIA) as reported previously (19). In brief, IGF-1 was separated from binding proteins by acid/ethanol precipitation. Standard curves were generated using rhIGF-1. The RIA used a rabbit anti-human IGF-1 antibody, which does not cross-react with rat IGF-1 at the dilutions used.

Collagen hydroxyproline assay.   A part of the frozen LV tissue was lyophilized to constant dry weight. Dry samples were weighed and homogenized thoroughly in distilled water. The homogenates were hydrolyzed in alkali and the hydroxyproline concentration was determined using the colorimetric method developed by Stegemann et al. (20). Collagen concentration in the myocardium was calculated by assuming that collagen weighs 7.46 times the measured weight of hydroxyproline (21).

Northern blot analysis.   Total RNA was isolated from the LV tissue using the acid guanidinium thiocyanate-phenol-chloroform method. Total RNA (20 µg) was subjected to formaldehyde/agarose-gel electrophoresis and transferred to nylon filters by overnight capillary blotting. The filters were hybridized with the following 32P-labeled cDNA probes listed below. The cDNA probes were radiolabeled with [{alpha}-32P]dCTP (Amersham) using a random-priming method. The blots were analyzed with a FUJIX bioimage analyzer BAS 2000. Results were normalized with signals of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA.

The cDNA probes used in this study were the following: 1) atrial natriuretic peptide (ANP), a 362-bp fragment isolated by reverse transcriptase–polymerase chain reaction (RT-PCR) amplification with primers complementary to the published sequence for rat mRNA (22); 2) myosin heavy chain (MHC), a 524-bp fragment isolated by RT-PCR amplification with primers complementary to the published sequence for rat mRNA (23). Because this fragment was 98.5% identical, it crossed with both {alpha}- and ß-MHC isoforms (total MHC); 3) sarcoplasmic reticulum Ca2+-ATPase (SERCA) 2a, a 518-bp fragment isolated by RT-PCR amplification of rabbit cardiac total RNA corresponding to nucleotides 2617-3359 of the cDNA encoding the rabbit cardiac/slow twitch skeletal muscle sarcoplasmic reticulum Ca2+-ATPase (24); 4) GAPDH, the human cDNA purchased from the American Type Culture Collection. The PCR products were purified and subcloned into pBluescript (Stratagene). The DNA sequences were confirmed by dideoxy-chain termination.

"Hot" RT-PCR analysis of MHC isoform mRNA.   The first-strand cDNA was synthesized with a cDNA synthesis kit (Pharmacia). ‘Hot’ RT-PCR was performed as previously described by Petrou et al. (25). In brief, PCR amplifications were achieved with the following oligonucleotides: forward primer, GAGGCGGTGCAGGAGTGTAG; and reverse primer, ACCTGGGACTCGGCAATGTC, which were identical to sequences for both rat {alpha}- and ß-MHC isoforms (23). The PCR was performed in a 50-µl reaction volume containing 200 µmol/liter dNTP, 40 µmol/liter of each specific primer, 10 mmol/liter of Tris-HCl, 50 mmol/liter of KCl, 1.5 mmol/liter of MgCl2, 0.001% gelatin, 1.5 U of Taq polymerase (Takara, Japan), and 1 µCi of 32P-dCTP (Amersham). The iso-RNAs were distinguished by digestion of 10 µl of the PCR reaction mixture with 10 U of Tru 9I (10 U/µl, Promega) in a standard buffer at 65°C for 120 min. Fragments ({alpha}-MHC, 524 base pairs; ß-MHC, 391 and 133 base pairs) were separated on a 5% polyacrylamide gel and analyzed with the bioimage analyzer. The ratio between the two complementary isoforms was determined.

Statistical analysis.   The animal survivals were analyzed by standard Kaplan-Meier analysis with the log-rank test. The unpaired Student t-test was employed for other statistical comparisons between two groups. Relationships between two variables were tested by linear regression analysis. The main effects of the drugs were tested using a two-factor analysis of variance (ANOVA) for repeated measures, and differences at specific time points between the groups were assessed using one-factor ANOVA with post hoc comparisons by the Fisher protected least-significant-difference test. In all tests, a p value <0.05 was considered statistically significant.


   Results
Top
 Abstract
 Materials and methods
 Results
Discussion
 References
 
Survival rate.   Figure 1 shows the survival curves of the treated rats. All rats in the control group died of LV dysfunction and pulmonary congestion between 14.5 and 18.5 weeks (mean ± SEM; 16.8 ± 0.5 weeks). The survival rate at 17 weeks was 50.0% in the control group, 12.5% in the IGF group, and 90.0% in the temocapril group. The Kaplan-Meier survival analysis demonstrated a significant shortening of survival in the IGF-1 group (15.6 ± 0.3 weeks) compared with that in the control group (p = 0.022). In contrast, the ACE inhibitor treatment produced a substantial improvement in survival (19.5 ± 0.6 weeks) compared with that of the control group (p < 0.01). The longest survival time in the temocapril group was 22.7 weeks. The difference in survival rate between the IGF-1 and temocapril groups was significant at p < 0.001.



View larger version (16K):
[in this window]
[in a new window]
  		Figure 1 The effect of human recombinant IGF-1 and temocapril on animal survival. Kaplan-Meier survival curves for the IGF-1-treated group (n = 8; open circles), the temocapril-treated group (n = 10; filled circles), and the control group (n = 10; open inverted triangles). The IGF-1, temocapril, or placebo was administrated from 11 weeks of age. *p < 0.01 or #p < 0.05 vs. control (log-rank test).

 
We investigated several parameters to determine whether significant differences could be found among the three groups that might correlate with these differences in survival.

Sbp and echocardiographic changes.   There were no significant differences in in vivo SBP among the three groups (Table 1). Figure 2 demonstrates changes of EDD (A), LV/BW (B), RWT (C), and LV FS (D) during the four-week drug intervention. In the IGF-1 group, the EDD and LV/BW were increased by 15% and 18%, respectively, over the control group. In contrast, in the temocapril group, these increases were significantly smaller than those in the control group (by 18% and 14%, respectively). The RWT decreased by 5% to 9% in all three groups during the treatment course, but no significant difference was found. At 15 weeks, the LV FS in the IGF group (45 ± 3%) was not significantly different from that in the control group (49 ± 2%), although it tended to decrease (p = 0.08). The LV FS in the temocapril group (59 ± 1%) was significantly higher (p < 0.05) than that in either the IGF or control group. Thus, while the chronic administration of IGF-1 induced supplemental LVH, it did not prevent progressive LV dysfunction. In contrast, chronic treatment with ACE inhibitor (at a dosage without hypotensive effect) prevented the progressive LVH, which was associated with a preserved LV contractile state.


View this table:
[in this window]
[in a new window]
  		Table 1 Somatic and Cardiac Growth at 15 Weeks

 


View larger version (24K):
[in this window]
[in a new window]
  		Figure 2 The effect of human recombinant IGF-1 and temocapril on echocardiographic data. The graphs show serial transthoracic echocardiographic measurements, LV end-diastolic dimension (LV EDD) (A); estimated LV weight to body weight ratio (LV/BW) (B); relative wall thickness (RWT) (C); and LV fractional shortening (FS) (D), for the IGF-1-treated group (n = 8; open circles), the temocapril-treated group (n = 10; filled circles), and the control group (n = 10; open inverted triangles). Values are expressed as mean ± SEM. *p < 0.05.

 
Somatic and cardiac growth at 15 weeks.   In the IGF-1 group, rats showed a significantly greater increase in body weight than did those in the control group, even in the second week of treatment (data not shown). At 15 weeks (Table 1) the difference in BW reached 15% (p < 0.05). Both the LV and right ventricular (RV) weights were greater by 17% (p < 0.05) and 20% (p < 0.05), respectively. The LV mass index normalized to the tibial length (LV/TL) was also significantly greater (p < 0.01). In contrast, in the temocapril group, while the BW at 15 weeks was 8% greater (p < 0.01), the LV and RV weights did not increase over those of the control group (p = 0.08 and 0.48, respectively). Consequently, the LV/TL was significantly reduced by 8% (p < 0.05).

Serum IGF-1 levels.   At 15 weeks, exogenous rhIGF-1 levels were measured by RIA. In the temocapril and control groups, plasma rhIGF-1 was not detected. In the IGF-1 group, the level was 875 ± 126 ng/ml (n = 7).

The mRNA levels of ANP, SERCA2a, and MHC isoforms, and collagen content in LV.   The LV tissue mRNA levels of ANP are shown in Table 2. Although these values tended to decrease in the IGF-1 and temocapril groups, no significant changes were shown in ANP mRNA expression during the treatment course. It was also evident that the SERCA2a mRNA levels were not affected by IGF-1 or ACE inhibitor treatments in this experimental protocol (Table 2).


View this table:
[in this window]
[in a new window]
  		Table 2 mRNA Levels and Collagen Content at 15 Weeks

 
No significant differences were seen in the collagen concentration in the LV myocardium, calculated from the hydroxyproline content, among the three groups (Table 2). Thus, chronic IGF-1 administration or ACE inhibitor therapy of sub-antihypertensive dosage did not affect collagen accumulation, at least during the observation period.

The total amount of MHC mRNA expression was measured by Northern blot analysis (as the value normalized to GAPDH mRNA expression), while the ratio of {alpha} to ß isoforms was determined by "Hot" RT-PCR analysis using the same tissue samples (Fig. 3). The amount of {alpha} or ß isoform mRNA was calculated from these measures. No significant differences existed in the total MHC mRNA levels among the three groups (p = 0.31), while the level in the IGF-1 group tended to decrease and that in the temocapril group tended to increase (Fig. 3A). In contrast, the ratio of {alpha}- to ß-MHC mRNA was decreased by 53% in the IGF-1 group (0.23 ± 0.02) and increased by 45% in the temocapril group (0.71 ± 0.04), when compared with this ratio in the control group (0.49 ± 0.09; p < 0.01 between any two groups). By adapting the ratio values to the total amount of MHC mRNA, we found that the {alpha}-MHC mRNA level was decreased by 52% in the IGF-1 group (p < 0.01 vs. both the control and temocapril groups), while it increased by 58% in the temocapril group (p < 0.01 vs. the control group) (Fig. 3B). Meanwhile, there were no differences in the ß-MHC mRNA levels among the three groups (Fig. 3C). From these results, we plotted the relationships between the {alpha}-MHC mRNA level and the corresponding LV function (FS) for each animal. As shown in Figure 4, there was a strong correlation (r = 0.85, p < 0.01) between these two measures.



View larger version (31K):
[in this window]
[in a new window]
  		Figure 3 Results of measurement of the MHC mRNA in the LV myocardium of each group. The ratios of MHC isoform mRNA and total MHC mRNA (A) were measured by "Hot" RT-PCR (D, upper panel) and Northern blot analysis (D, lower panel), respectively. The amount of {alpha} (B) or ß (C) isoform mRNA was calculated from these measures. Values are expressed as mean ± SEM. *p < 0.05.

 


View larger version (12K):
[in this window]
[in a new window]
  		Figure 4 Relationship between {alpha}-MHC mRNA level and LV function in all groups. The linear regression analysis between {alpha}-MHC mRNA level and LV fractional shortening (FS) shows a tight correlation (r = 0.857, p < 0.01). Open circles, filled circles, and open inverted triangles indicate rats of the IGF, temocapril, and control groups, respectively.

 

   Discussion
Top
 Abstract
 Materials and methods
 Results
 Discussion
References
 
In contrast to our initial hypothesis, the hypertensive rats treated with hr IGF-1 demonstrated a poorer prognosis than did untreated, control animals. Supplemental hypertrophy with IGF-1 thus merely accelerated LV dilation and functional deterioration in the rat with LVH. Conversely, chronic ACE inhibition with a sub-antihypertensive dose in these hypertensive animals demonstrated a longer survival that was associated with reduced LV mass and improved LV function. Further investigation indicated that the MHC-isoform transcript in the myocardium, rather than the total myocardial mass, was a marker for distinguishing between and characterizing these animal groups. Thus, our data are consistent with the idea that the qualitative modulation of contractile proteins should be crucial for myocardial performance and animal prognosis, and the chronic IGF-1 treatment may not be effective when it aggravates such modulation of the contractile proteins.

The IGF-1 treatment in heart failure animals.   In previous reports, it was confirmed that chronic IGF-1 or GH administration in normal rats and mice caused substantial myocardial hypertrophy, which was associated with augmented myocardial contractility in vivo as well as in vitro (7,26,27). In contrast, the effects of such treatments under pathological conditions are controversial. Using the myocardial-infarction rats with LV dysfunction, Duerr et al. (7) reported that chronic IGF-1 treatment enhanced LVH and improved function, which appeared to be due primarily to the reduction in systemic vascular resistance. Cittadini et al. (28) showed the suppression of early LV remodeling and preservation of LV function after three weeks of treatment with GH. In contrast, Shen et al. (11) demonstrated that a four-week GH treatment did not affect LV performance or systemic vascular dynamics in heart failure dogs under rapid ventricular pacing. These inconsistent observations could be due to differences in the pathogenesis of heart failure and possible differences between IGF-1 and GH treatments (27). However, it may be worth emphasizing that, essentially, these animals were already decompensated with decreased RWT ratios when the treatment with IGF-1 was started. In contrast, in the present study, the administration of IGF-1 was begun while the cardiac function was maintained and the LV showed a typical concentric pattern. Thus, the present study examined for the first time whether the chronic IGF-1 treatment could exert beneficial effects on the primary prevention of heart failure in the setting of existing LVH.

Possible contributions of endogenous IGF-1 to heart failure.   Acquired abnormalities of the GH/IGF-1 axis have been described in severe heart failure, and it was reported that deficient IGF-1 may predict altered body composition, as well as cytokine and neurohumoral activations in human heart failure (29). These considerations suggest that the efficacy of IGF-1 treatment might be associated with existing decreases in plasma IGF-1. A possible relationship between impaired IGF-1 utilization and elevated plasma angiotensin-II (AT-II) levels was reported in Sprague-Dawley rats (30). In addition, DS rats with high-salt diet may be insulin-resistant, which may cause reduced bioavailability of IGF-1 (31,32). Failure of chronic IGF-1 treatment to prevent the transition to heart failure in our model could be associated with these conditions. However, the extraordinarily high concentration of serum IGF-1 produced definitive somatic as well as cardiac growth in our experimental setting. Our study especially focused on the stage before heart failure. In addition, as reported previously (30), the hypertensive DS rats showed normal plasma AT-II (but see below regarding tissue AT-II) and IGF-1 levels.

Effects of IGF-1 on LV myocardium in transition to heart failure.   With the same experimental protocol, we previously reported the significant activation of the LV tissue angiotensin-II system during the development of compensatory hypertrophy, which was sustained even after the transition to heart failure (manuscript under consideration). Chronic ACE inhibition with temocapril significantly suppressed LVH, resulting in the preservation of LV performance and improvement of survival. In the present study, we treated rats with temocapril in a dose that was 1/20th of the previous dose so as to make its anti-hypertensive effects negligible. Even with this smaller amount, ACE inhibition consistently showed an anti-hypertrophic effect and an improvement in survival. Taken together with the results from the IGF-1 group, we further confirmed that the LV myocardial mass could not provide information on the animal’s condition, at least not directly. But why was the additional hypertrophy unable to reduce the mechanical stress of the unit myocardium, thus resulting in progression of LV dysfunction? One possibility could be morphological changes of the ventricle. As shown in Figure 2C, the change of values of the relative wall thickness in the IGF group was larger than that in the control or ACE inhibitor group, although the levels were not statistically significant. Combined with relative changes in EDD (Fig. 2A), the data indicate that IGF treatment increased LV eccentricity. Thus, myofibrillar supply by IGF treatment might accelerate eccentric ventricular growth and the adverse process of remodeling in the hypertrophied myocardium.

Another possibility is an alteration in the tissue components or in the subcellular proteins that regulate the cell contractions. Because massive fibrosis is common in hypertrophic hearts of patients with acromegaly (6), we quantitatively assessed the hydroxyproline content in the LV tissue. However, at least during the examination period, the collagen content did not differ among the groups and it was not associated with the LV function. Abnormalities of Ca2+ handling have been reported as a candidate for producing cardiac dysfunction (33). Tajima et al. (34) reported that long-term GH therapy improved contractile reserve with an increase of SERCA2a expression in rats with postinfarction heart failure. However, we found that there was no change of SERCA2a mRNA in our animals with IGF-1 or temocapril. In addition, the ANP mRNA levels at 15 weeks were equally elevated among the groups. Taken together, in the present study, it appeared not likely that either the extracellular matrix or the subcellular components such as Ca2+ handling proteins played critical roles. Further investigations are needed to establish the effects of chronic IGF-1 therapy on these components by using animal models in which their changes are clearly demonstrated.

The remaining possibility was the characteristic changes of myofibrillar components. Along with the process of pressure-overload hypertrophy, our animals showed an increase in ß-MHC mRNA expression with a reciprocal decrease in {alpha}-MHC mRNA, a well-established fetal-type gene re-expression in the hypertrophic rodent heart. In these rats, at the beginning of the pharmacological treatments (at 11 weeks of age), the ratio of {alpha}- to total MHC mRNA was 54.6% (n = 5, unpublished data), which decreased to 31.5% during the following four weeks (in the control group). Interestingly, in contrast to the temocapril group, the reduction of {alpha}-MHC was accelerated in the IGF-1 group.

In addition, our regression analysis demonstrated an intimate relationship between the levels of {alpha}-MHC mRNA and the LV FS in all three animal groups. Because {alpha}-MHC has triple the ATPase activity of ß-MHC, the expression ratio of these isoforms may be critical to maintain contractile velocity and diastolic relaxation with a heart rate over 300 beats/min such as in the rat heart (35,36). Of course, as we have not determined the relation between the mRNA abundance and the amount of MHC isoform protein, a linear relationship may not necessarily imply a direct role of the {alpha}-MHC mRNA on the contractile properties of the diseased myocardium. Other unmeasured compositional changes in the myocardium may contribute to the progression of LV dysfunction. However, the MHC isoform finding at least supports our hypothesis that IGF-1 and ACE inhibitors cause different characteristic changes in the myofibrillar components, which in turn affects prognosis.

Studies of Donath et al. (37) do not agree with our results. However, other reports have shown that IGF-1 or GH caused down-regulation of myocardial {alpha}-MHC in vitro and in vivo as in our case (25,38). Mayoux et al. (26) reported that chronic GH hypersecretion in rats leads to a decrease in the proportion of {alpha}-MHC both at the protein and mRNA levels. Concomitantly, in their skinned fiber study, increases in maximal active tension and stiffness were observed in the GH rats, indicating an increase in the number of active cross-bridges. Strömer et al. (27) demonstrated an enhancement of contractility that was associated with an impairment of relaxation by chronic IGF-1 or GH treatment in normal rats. They also suggested that these changes were most likely caused by an alteration at the level of the myofilament because of insignificant changes in the corresponding Ca2+ transients. Thus, our hypothesis regarding the IGF-1-mediated changes in the properties of the contractile component appears to be consistent with their observations. Indeed, at 13 weeks, our IGF-1-treated rats showed a tendency toward enhancement of systolic performance by in vivo echocardiography (FS: 58.5 ± 1.4% in the IGF group vs. 52.5 ± 2.7% in the control group; p = 0.152). At 15 weeks, however, rats in the IGF-1 group showed a marked progression of LV dysfunction. These results suggest that IGF-1 may produce a better contractile performance as a net result in the normal myocardium, but this beneficial effect may be limited in the diseased myocardium, which is already deficient in several functional advantages such as {alpha}-MHC abundance.

Effects of IGF-1 versus ACE inhibitor on MHC composition.   In rodents, the MHC composition of the ventricular myocardium was reported to be >80% {alpha}-isoform. Numerous stimuli such as thyroid hormone, exercise, aging, and pressure overload have been shown to change the MHC composition (39). Our rat model showed a 68% reduction of {alpha}-MHC mRNA abundance during the transition to heart failure (from 11 to 17 weeks). Therefore, a modification of {alpha}-MHC expression might be critical in LV function and prognosis in our animals. In contrast, in humans, because it had been reported that the normal heart is largely devoid of {alpha}-MHC (40,41), the isoform shift in developing heart failure was once thought to be irrelevant. However, recently, using the RT-PCR method, Nakao et al. (42) reported that {alpha}-MHC mRNA constituted a significant part of the total MHC gene expression in the normal human LV ({alpha}/total MHC mRNA: 33 ± 19%), which substantially decreased in end-stage failing human LV (2.2 ± 3.5%). Lowes et al. (43) also observed the similar change of {alpha}-MHC mRNA expression in human hearts in disease. Other investigators concluded that the reduction of {alpha}-MHC mRNA expression corresponded to decreased myosin or myofibrillar ATPase activity in the failing human heart (44,45) and was associated with the systolic dysfunction. Therefore, a modification of {alpha}-MHC expression might be critical not only in small animals but also in larger animals, including humans.

The beneficial effects of ACE inhibitors on failing myocardium are repeatedly documented in both experimental and clinical settings (3,46). Our present study supports the idea that an increase in {alpha}-MHC gene expression should be one of the major mechanisms for the beneficial effect of ACE inhibitors. In contrast, our study suggests that clinical application of IGF-1 or GH should be undertaken cautiously in terms of such alterations of the contractile elements. Further and long-term studies in other animal models and in humans are needed to determine critical effects of this MHC shift in its relation to ventricular relaxation, force-frequency responses, and energy utilization.


   Footnotes
 
This work was supported in part by Grants-in-Aid from the Ministry of Education, Science, and Culture, Japan (06454291 and 07557343), research grants from the Ministry of Health and Welfare, Japan (7A-2 and 7A-4), a Japan Heart Foundation–Pfizer Pharmaceutical grant for Research on Cardiac Failure (Y.K.), and a grant from the Tsujisaka Foundation in Kyoto University Graduate School of Medicine (Y.I.). We also thank Fujisawa Co. Ltd. (Osaka, Japan) and Sankyo Co. Ltd. (Tokyo, Japan) for their generous supply of rhIGF-1 and temocapril hydrochloride, respectively.


   References
Top
 Abstract
 Materials and methods
 Results
 Discussion
 References
 

  1. Katz AM. The cardiomyopathy of overload: an unnatural growth response in the hypertrophied heart. Ann Intern Med. 1995;121:363–371
  2. CONSENSUS Trial Study Group. Effects of enalapril on mortality in severe congestive heart failure: results of the Cooperative North Scandinavian Enalapril Survival Study (CONSENSUS). N Engl J Med. 1987;316:1429–1435[Abstract]
  3. Waagstein F, Caidahl K, Wallentin I, et al. Long-term ß-blockade in dilated cardiomyopathy: effects of short- and long-term metoprolol treatment followed by withdrawal and readministration of metoprolol. Circulation. 1989;80:551–563[Abstract/Free Full Text]
  4. Sutsch G, Bertel O, Kiowski W. Acute and short-term effects of the nonpeptide endothelin-1 receptor antagonist bosentan in humans. Cardiovasc Drugs Ther. 1997;10:717–725[CrossRef][Medline]
  5. Rinderknecht E, Humbel RE. The amino acid sequence of human insulin-like growth factor I and its structural homology with proinsulin. J Biol Chem. 1986;253:2769–2776
  6. Sacca L, Cittadini A, Fazio S. Growth hormone and the heart. Endocrin Rev. 1994;15:555–573[CrossRef][Medline]
  7. Duerr RL, Huang S, Miraliakbar HR, et al. Insulin-like growth factor-I enhances ventricular hypertrophy and function during the onset of experimental cardiac failure. J Clin Invest. 1995;95:619–627[Medline]
  8. Yang R, Bunting S, Gillett N, et al. Growth hormone improves cardiac performance in experimental heart failure. Circulation. 1995;92:262–267[Abstract/Free Full Text]
  9. Fazio S, Sabatini D, Capaldo B, et al. A preliminary study of growth hormone in the treatment of dilated cardiomyopathy. N Engl J Med. 1996;334:809–814[Abstract/Free Full Text]
  10. Osterziel KJ, Strohm O, Schuler J, et al. Randomized, double-blind, placebo-controlled trial of human recombinant growth hormone in patients with chronic heart failure due to dilated cardiomyopathy. Lancet. 1998;351:1233–1237[CrossRef][Medline]
  11. Shen Y-T, Woltmann RF, Appleby S, et al. Lack of beneficial effects of growth hormone treatment in conscious dogs during development of heart failure. Am J Physiol. 1998;274:H456–H466
  12. Inoko M, Kihara Y, Morii I, et al. Transition from compensatory hypertrophy to dilated, failing left ventricles in Dahl salt-sensitive rats. Am J Physiol. 1994;267:H2471–H2482
  13. Inoko M, Kihara Y, Sasayama S. Neurohumoral factors during transition from left ventricular hypertrophy to failure in Dahl salt-sensitive rats. Biochem Biophys Res Commun. 1995;206:814–820[CrossRef][Medline]
  14. Iwanaga Y, Kihara Y, Hasegawa K, et al. Cardiac endothelin-1 plays a critical role in the functional deterioration of left ventricles during the transition from compensatory hypertrophy to congestive heart failure in salt-sensitive hypertensive rats. Circulation. 1998;98:2065–2073[Abstract/Free Full Text]
  15. Dahl LK, Heine MA, Tassinari L. Role of genetic factors in susceptibility to experimental hypertension due to chronic excess salt ingestion. Nature (London). 1962;194:480–482[Medline]
  16. Iwai J, Heine MA. Dahl salt-sensitive rats and human essential hypertension. J Hypertens. 1986;4(Suppl):S29–S31
  17. Takemoto M, Egashira K, Tomita H, et al. Chronic angiotensin-converting enzyme inhibition and angiotensin-II type 1 receptor blockade: effects on cardiovascular remodeling in rats induced by the long-term blockade of nitric oxide synthesis. Hypertension. 1997;30:1621–1718[Abstract/Free Full Text]
  18. Troy BL, Pombo J, Rackley CE. Measurement of left ventricular wall thickness and mass by echocardiography. Circulation. 1972;45:602–611[Abstract/Free Full Text]
  19. Breier BH, Gallaher BW, Gluckman PD. Radioimmunoassay for insulin-like growth factor I: solutions to some potential problems and pitfalls. J Endocrinol. 1991;128:347–357[Abstract/Free Full Text]
  20. Stegemann H, Stalder K. Determination of hydroxyproline. Clin Chim Acta. 1967;18:267–273[CrossRef][Medline]
  21. Gunja-Smith Z, Morales AR, Romanelli R, Woessner JF Jr. Remodeling of human myocardial collagen in idiopathic dilated cardiomyopathy. Role of metalloproteinases and pyridinoline cross-links. Am J Pathol. 1996;148:1639–1648[Abstract]
  22. Maki M, Takayanagi R, Misono KS, et al. Structure of rat atrial natriuretic factor precursor deduced from cDNA sequence. Nature. 1984;309:722–724[CrossRef][Medline]
  23. McNally M, Gianola M, Leinwand A. Complete nucleotide sequence of full length cDNA for rat alpha cardiac myosin heavy chain. Nucl Acids Res. 1989;17:7527–7528[Free Full Text]
  24. MacLennon DH, Brandl CJ, Korczak B, Green NM. Amino-acid sequence of a Ca2+-Mg2+-dependent ATPase from rabbit muscle sarcoplasmic reticulum, deduced from its complementary DNA sequence. Nature. 1985;316:696–700[CrossRef][Medline]
  25. Petrou M, Wynne DG, Boheler KR, Yacoub MH. Clenbuterol induces hypertrophy of the latissimus dorsi muscle and heart in the rat with molecular and phenotypic changes. Circulation. 1995;92(Suppl II):483–489[Abstract/Free Full Text]
  26. Mayoux E, Ventura-Clapier R, Timsit J, et al. Mechanical properties of rat cardiac skinned fibers are altered by chronic growth hormone hypersecretion. Circ Res. 1993;72:57–64[Abstract/Free Full Text]
  27. Strömer H, Cittadini A, Douglas PS, Morgan JP. Exogenous administration of growth hormone and insulin-like growth factor-I alter intracellular Ca2+ handling and enhance cardiac performance. Circ Res. 1996;79:227–236[Abstract/Free Full Text]
  28. Cittadini A, Grossman JD, Napoli R, et al. Growth hormone attenuates early left ventricular remodeling and improves cardiac function in rats with large myocardial infarction. J Am Coll Cardiol. 1997;29:1109–1116[Abstract]
  29. Niebuer J, Pflaum CD, Clark AL, et al. Deficient insulin-like growth factor-I in chronic heart failure predicts altered body composition, anabolic deficiency, cytokine and neurohormonal activation. J Am Coll Cardiol. 1998;32:393–397[Abstract/Free Full Text]
  30. Brink M, Wellen J, Delafontaine P. Angiotensin-II causes weight loss and decreases circulating insulin-like growth factor-I in rats through a pressor-independent mechanism. J Clin Invest. 1996;97:2509–2516[Medline]
  31. Kotchen TA, Zhang HY, Covelli M, Blehschmidt N. Insulin resistance and blood pressure in Dahl rats and in one-kidney, one-clip hypertensive rats. Am J Physiol. 1991;261:E692–E697
  32. Laviades C, Gil MJ, Monreal I, et al. Tissue availability of insulin-like growth factor-I is inversely related to insulin resistance in essential hypertension: effects of angiotensin-converting enzyme inhibition. J Hypertens. 1998;16:863–870[CrossRef][Medline]
  33. Bristow MR. Why does the myocardium fail? Insights from basic science. Lancet. 1998;352(Suppl I):8–14[CrossRef]
  34. Tajima M, Weinberg EO, Bartunek J, et al. Treatment with growth hormone enhances contractile reserve and intracellular calcium transients in myocytes from rats with postinfarction heart failure. Circulation. 1999;99:127–134[Abstract/Free Full Text]
  35. Alpert NR, Mulieri LA. Increased myothermal economy of isometric force generation in compensated cardiac hypertrophy induced by pulmonary artery constriction in the rabbit. Circ Res. 1982;50:491–500[Free Full Text]
  36. Holubarsch CH, Goulette RP, Litten RZ, et al. The economy of force development, myosin isoenzyme pattern and myofibrillar ATPase activity in normal and hyperthyroid rat myocardium. Circ Res. 1985;56:78–86[Abstract/Free Full Text]
  37. Donath MY, Zierhut W, Gosteli-Peter MA, et al. Effects of IGF-1 on cardiac growth and expression of mRNAs coding for cardiac proteins after induction of heart hypertrophy in the rat. Eur J Endocrinol. 1998;139:109–117[Abstract]
  38. Decker RS, Cook MG, Behnke-Barclay M, Decker ML. Some growth factors stimulate cultured adult rabbit ventricular myocyte hypertrophy in the absence of mechanical loading. Circ Res. 1995;77:544–555[Abstract/Free Full Text]
  39. Swynghedauw B. Developmental and functional adaptation of contractile proteins in cardiac and skeletal muscles. Physiol Rev. 1986;66:710–730[Abstract/Free Full Text]
  40. Mercadier JJ, Bouveret P, Gorza L, et al. Myosin isozymes in normal and hypertrophied human ventricle myocardium. Circ Res. 1983;53:52–62[Abstract/Free Full Text]
  41. Bouvagnet P, Mairhofer H, Leger JO, et al. Distribution pattern of {alpha} and ß myosin in normal and diseased human ventricular myocardium. Basic Res Cardiol. 1989;84:91–102[CrossRef][Medline]
  42. Nakao K, Minobe W, Roden R, et al. Myosin heavy chain gene expression in human heart failure. J Clin Invest. 1997;100:2362–2370[Medline]
  43. Lowes B, Minobe W, Abraham WT, et al. Changes in gene expression in the intact human heart. J Clin Invest. 1997;100:2315–2324[Medline]
  44. Hajjar RJ, Gwathmey JK. Cross-bridge dynamics in human ventricular myocardium. Circulation. 1992;86:1819–1826[Abstract/Free Full Text]
  45. Alousi AA, Grant AM, Etzler JR, et al. Reduced cardiac myofibrillar Mg-ATPase activity without changes in myosin isoenzymes in patients with end-stage heart failure. Mol Cell Biochem. 1990;96:79–88[Medline]
  46. Pinto YM, Buikema H, Gilst WH, Lie KI. Activated tissue renin-angiotensin systems add to the progression of heart failure. Basic Res Cardiol. 1996;91(Suppl 2):85–90



This article has been cited by other articles:


Home page
 Cardiovasc ResHome page
M. Nahrendorf, S. Frantz, K. Hu, C. von zur Muhlen, M. Tomaszewski, H. Scheuermann, R. Kaiser, V. Jazbutyte, S. Beer, W. Bauer, et al.
Effect of testosterone on post-myocardial infarction remodeling and function
Cardiovasc Res, February 1, 2003; 57(2): 370 - 378.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
Y. Iwanaga, Y. Kihara, K. Inagaki, Y. Onozawa, T. Yoneda, K. Kataoka, and S. Sasayama
Differential Effects of Angiotensin II Versus Endothelin-1 Inhibitions in Hypertrophic Left Ventricular Myocardium During Transition to Heart Failure
Circulation, July 31, 2001; 104(5): 606 - 612.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iwanaga, Y.
Right arrow Articles by Sasayama, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iwanaga, Y.
Right arrow Articles by Sasayama, S.

 
  cardiology careers collections past issues search home